THE GARDENS” BULLETIN, SINGAPORE The Gardens” Bulletin, Singapore is a peer-reviewed Journal publishing original papers and reviews on a wide range of subjects: plant taxonomy (including revisions), phytogeography, floristies, morphology, anatomy, as well as horticulture and related fields, such as ecology and conservation, with emphasis on the plant life of the Southeast Asian-Pacific region. Dr. K.M. Wong Dr. Jana Leong-Skornickovă (Editor-in-Chief) (Managing Editor) S. Lee Y.W. Low Christina Soh (Graphics Editor) (Copy Editor) (Business Manager) Editorial Advisory Board Professor Sir Peter Crane Yale University (OLS Dr. Rogier P.]. de Kok Royal Botanic Gardens, Kew U.K. Dr. W.J]. Kress National Museum of Natural FHistory Smithsonian Institution RSSA Dr. David J]. Middleton Royal Botanic Garden Edinburgh U.K. Dr Kiat W. Tan Gardens By The Bay Dr. Nigel P. Taylor Singapore Botanic Gardens National Parks Board, Singapore Dr. I.M. Turner Singapore Botanic Gardens National Parks Board, Singapore Dr. J.F. Veldkamp Nationaal Herbarium Nederland The Netherlands Dr. Jun Wen National Museum of Natural History Smithsonian Institution U.S.A. Professor Nianhe Xia South China Institute of Botany» National Parks Board, Singapore PR. China Published twice yearly by the National Parks Board, Singapore, the annual subscription for the journal 1s Singapore $100.00 including postage. Overseas subsceribers should make payment in the form of bank draft or international money order in Singapore currency, payable to National Parks Board, Please forward payment to ““Accounts Receivable Section. National Parks Board, Headquarters, Singapore Botanic Gardens, 1 Cluny Road, Singapore 2595609”. Instructions for contributing authors (more details in http://www.sbg.org.sg/research/instructions-for-authors.pdf) Manuscripts should be sent by e-mail to or posted to The Editor, Gardens” Bulletin Singapore, Singapore Botanic Gardens, | Cluny Road, Singapore 259569. The language used is English. Prior to submission, it may be advisable to have manuscripts checked by someone fluent or proficient in that language. Contributions must not have been published or be under consideration elsewhere. There are no page charges. Submitted material cannot be returned. Authors currently opt for 50 paper offprints and/or a pdf reproduction of their contribution, gratis. Cover letter, submission and copyright. In your cover letter or message, state clearly you are submitting your manuscript (state title) for publication in the Gardens” Bulletin, Singapore. By submitting the manuscript(s), authors agree that upon acceptance, copyright of the entire work becomes the property ot the Singapore Botanic Gardens National Parks Board, Singapore. Authors must ensure all required permission has been obtained in writing to publish any material they present; proof may be required. Manuscripts are best submitted in electronic form (Microsoft Word 97-2003 preferred). Use Times New Roman, 10-point font, 1.5-line spacing. Do not send original artwork unless requested by the Editor. Number all pages serially including the title and abstract on the first. (continued on inside back cover) — 3 [ AA The Gardens” Bulletin Singapore VOL. 65(1) 2013 ISSN 0374-7859 CONTENTS P.C. Boyce and S.Y. Wong Studies on Schismatoglottideae (Araceae) of Borneo XXII: INI caiematie Aridarum monlanum tefound ......... memo ee eee eee eneaeaasee l P.C. Boyce and S.Y. Wong Studies on Schismatoglottideae (Araceae) of Borneo XXIII: Piptospatha colata and P deceptrix, taxonomic novelties from Borneo ............... Ji R. Gogoi and S. Borah Musa markkui (Musaceae), a new species from Arunachal Pradesh, India ........... 19 R. Gogoi and S$. Borah Two new species and a new record for Co/ocasia (Araceae: Colocasieae) ii tuuiachal Pradesh. Norţheast India ........<< ceea ee eee ceara aaa atatea atata aa araaia sia aaa aaa 27 R. Kishor and J. Leong-Skornitkovă Zingiber kangleipakense (Zingiberaceae): ENE eee li na VARIpIIr., INCI, «otet ie oare o atare atacate are aa aia ela ta arata le Ale ia 39 J.D. Mood, L.M. Prince, J.F. Veldkamp and S. Dey The history and identity of Boesenbergia longiflora (Zingiberaceae) iile scripildas:0l-fhye related new taxa << see goe oo aie slot area 3 ia aa ial die 47 M.F. Newman Valid publication of Boesenbergia aurantiaca (Zingiberaceae) ..................... 97 H.-J. Tillich and J. Leong-Skornitkovă Aspidistra jiewhoei (Asparagaceae), a new species from north Vietnam ............ 101 Y.H. Tong, W.B. Xu, Y.F. Deng, K.M. Wong and N.H. Xia Rubovietnamia sericantha (Rubiaceae: Gardenieae), a new combination.ând notes on the penus in China 107 I.M. Turner Additions to The Plant Taxa of H.N. Ridley, 4. The Primitive Angiosperms (Austrobaileyales, Canellales, Chloranthales, Laurales, Magnoliales, Nymphaeales and Piperales) ................ 115 J.F. Veldkamp Nomenclatural notes on Eugenia reinwardtiana (Myrtaceae) and more'or less associate d name se E 14157, Date of publication: 30 June 2013 Copyright O National Parks Board Singapore Botanic Gardens 1 Cluny Road Singapore 259569 Printed by Oxford Graphic Printers Pte Ltd Gardens” Bulletin Singapore 65(1): 1-5. 2013 ] Studies on Schismatoglottideae (Araceae) of Borneo XXII: The enigmatic Aridarum montanum refound P.C. Boyce! and S.Y. Wong? 'Pusat Pengajian Sains Kajihayat (School of Biological Sciences), Universiti Sains Malaysia 11800 USM, Pulau Pinang, Malaysia phymatarum(a googlemail.com "Department of Plant Science & Environmental Ecology, Faculty of Resource Science & Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia sywong(Afrst.unimas.my ABSTRACT. Aridarum montanum Ridl., a species known from a single herbarium specimen allegedly collected on Gunung (Mt) Santubong, Sarawak, Malaysian Borneo in 1909, has been refound on exposed shales in Sri Aman Division, and Sarikei Division, Sarawak, and subsequently flowered in cultivation. Morphological differences of the new collection compared with the original description and figure are catalogued and commented upon. An amended and expanded species description is provided, and the plant is illustrated in habitat, and from flowering cultivated material. Speculations on the probable location origin of Brooks” type material are proffered. Keywords. Aroid, Mount Santubong, rare species, Sarawak, shales Introduction Aridarum montanum Ridl., the type species of the genus, has not been recollected since Cecil Joslin Brooks gathered a single specimen, purportedly on Gunung (Mt) Santubong, and now deposited in the Natural History Museum, London (BM). Boyce & Wong (2011) outlined the few facts known pertaining to A. montanum, emphasizing that numerous surveys of the supposed type locality, a large sandstone mountain situated on a peninsula jutting into the South China Sea approximately 35 km north of Kuching, the state capital of Sarawak, had failed to locate the plant, although another quite different Aridarum (A. nicolsonii Bogner) is abundant there. Recollection of A. montanum from a two quite separate very wet shale-dominated sites, one in Sri Aman Division and the other in Sarikei Division, coupled with the persistent failure to locate plants of this species at the supposed type locality on much drier sandstone ecology, raises the probability that Brooks” label data are in error. Brooks was in Sarawak during 1900-1910, employed as a metallurgical chemist by the gold-exploitation arm of the Borneo Co. Ltd. During this period he collected a wide range of wildlife, including plants, although mainly ferns. Data for Brooks” fieldwork are often incomplete, and there are doubts over the numbering of at least part 2 Gard. Bull. Singapore 65(1) 2013 of his collections. Brooks” Borneo fieldwork was concentrated almost exclusively in west Sarawak. He made collections on Gunung (G.) Santubong (c. 144 N 110*20'E), G. Pueh (c. 1*”48'N 109*41'E), G. Kapor (c. 1*23'N 110*7'E), G. Singai (c. 1*30'18.28"N 110*10'21.36"E), the Banjaran Bungo (c. 1*16'N 110*9E), Bau (c. 1%25'N 110%9'E), Bidi (c. 123'N 110*8'E), and Tringgus (c. 1*14N 110*5'E). With the exception of Banjaran Bungo, none of the above areas has exposed shales. Gunung Santubong, G. Singai, and Tringgus are predominantly sandstone; G. Kapor and Bidi are forested karst limestone, while G. Pueh is granite. Our new collections coupled with high levels of “geological endemism” present among aroids strongly favours A. montanum being a shale-obligate. Brooks” only documented excursion away from this general area was in 1908 when he ventured to the source of the true right tributary of the Sungai Sarawak, afterwards continuing to the headwaters of the Sungai Sambas where it rises in the Bengkayum (Bengkayang) Mountains (G. Niyut and G. Bentuang) NE of Pontianak, in modern Kalimantan Barat, Indonesian Borneo. Brooks returned to Sarawak from this expedition by way of Siluas and G. Penrissen (Brooks 1911). These areas do have exposed shales, and furthermore there are floristic links with Banjaran Bungo and via the Klingkang range to the border areas of Lubok Antu, close to one of the new collections of A. montanum. The Sarawak Banjaran Bungo is botanically reasonably well sampled and to date A. montanum has never been located there. On balance it seems most likely that Brooks” collection was made during the trip to the headwaters of the Sungai Sambas. Aridarum montanum Ridl., ]. Bot. 51: 201(—202), pl. 527 (1913); Bogner & Hay, Telopea 9(1): 186 (2000); Boyce & Wong, Malayan Nat. J. 63(4): 613-618, Figs. 2 & 3 (2011). TYPE: CU. Brooks 1035, Malaysian Borneo, Sarawak, Kuching Division, Santubong (but see above), Oct 1909 (holo BM!). (Fig. 1) Trailing-pendent or tufted obligate rheophyte to c. 25 cm. Stem initially condensed, later elongating and often branching from the base, trailing portions to c. 35 cm (or more?), very slender, 3-4 mm diam., all except the oldest portions clothed with tightly fitting red-brown netted fibres derived from the prophylls and cataphylls, and slender adhering sinuous green roots. Leaves numerous, carried in dense tufts at the tips of the stems, often two or three leaf tufts basal to these stems; peziole 0.2—3 cm long, c. | mm diam., sheathing at the very base, the wings extended into a narrowly triangular ligular portion 2.5-3 cm long, drying red-brown; blade linear-lanceolate, stiffly coriaceous, deep green, 2-10 cm long * 3.5-4.5 mm wide, base very narrowly cuneate, apex very narrowly acute and apiculate for 0.5-1 mm; midrib abaxially very prominent, adaxially more or less flush with the lamina; primary lateral veins not differentiated; secondary venation more or less obscure, running into a relatively thick marginal vein; tertiary venation very obscure. Inflorescence solitary; peduncle much exceeding the petioles, 9-10 cm long, c. 0.8 mm diam, green. Sparhe narrowly ovate, apically acute, unconstricted, 1.5-2 cm long, initially green, late in development (1-2 days prior to opening) turning entirely white; spathe limb gaping at pistillate anthesis, the 199) Aridarum montanum in Sarawak interpreted Fig. 1. Aridarum montanum Ridl. A. Plants in habitat on shale waterfall. Note the long, almost naked stems. B. Flowering shoot. Note the very narrow leaf blades, the conspicuous ligules, and the netted fibre covering the naked stem C. Inflorescence at pistillate anthesis, with the spathe gaping. D. Spadix, with the spathe artificially removed. Note the convex connective and very long setiform terminus to the thecae. E. Alcohol-preserved spadix. All from PC.Boyce er al. AR-3728. (Photos: A, Mike Lo; B-E, Peter C. Boyce) 4 Gard. Bull. Singapore 65(1) 2013 upper 2/3 caducous at staminate anthesis, at which time the lower persistent 1/3 flares into an obconic cup. Spadix 1.4—1.5 cm long, c. 3 mm diam., subeylindric, distally tapering to an acute apex; pistillate flower zone 2-3 mm long, about three irregular whorls of subglobose-oblong pistils c. 0.5 mm diam.; stigma sessile, button-like, narrower than the pistils, c. 0.4 mm diam., papillate, centrally impressed; staminate flower zone contiguous with pistillate zone, c. 1.2 cm long, c. 2.5 mm diam., fertile to the acute apex; stamens crowded, arranged in pairs, more or less ellipsoid and the pairs rhombohexagonal from above, longitudinally aligned (with respect to spadix axis), c. 1.2—1.5 mm * 0.3—0.4 mm, convex in nature, drying with a deep longitudinal excavation; thecae on the distal and proximal (with respect to spadix axis) sides of the anther, base triangular, the remainder a long straight very slender horn c. 7 mm long, these folded in horizontally across the top of and meeting in the middle of the anther, elevating somewhat at staminate anthesis. Fruiting spathe broadly obconic, white. Fruit unknown. Other specimens examined: MALAYSIAN BORNEO. Sarawak. Sri Aman, Lubok Antu, Batang Lemanak, 01*09'N 111*39E, PC.Boyce er al. AR-3728 (SAR); Sarikei, Ulu Sarikei, Air Terjun Ruan, 01*55'02.0"N 111%29'10.7"E, PC.Boyce & S.Y Wong AR-4100 (SAR). Distribution. Known with certainty only the two localities reported here. Ecology. Shale cascades and small waterfalls under very wet lowland forest; 25—60 m asl. Notes. Recollection of A. montanum has revealed critical inaccuracies in the original description and figure (Ridley 1913), and also interpretative misconceptions in the description provided by Bogner & Hay (2000). Inaccuracies in Ridley's description and figure are the excavation of the stamen connective, and the supposed presence of triangular-based, setiform sterile flowers at the “base” of each stamen. The connective excavation 1s an artefact resulting from shrinkage during drying for preservation. In nature the stamen connective is markedly convex, forming a pronounced dome between the thecae horns (Fig. 1D). It remains so in alcohol, although the stamen pairs, which are appressed when fresh, shrink laterally when spirit-preserved, revealing deep sutures between each pair of stamens (Fig. 1E). Ridley's sterile flowers attached to each stamen are, in fact, the thecae, one on each end of the stamen, and comprising a triangular somewhat gibbous basal portion (the actual theca) and a long, setiform terminus though which the pollen is released. Bogner & Hay's description contains the following statement: “interpistillar staminodes few at the base of the female zone, shortly stipitate, spindle-shaped, narrower and shorter than the pistils (interpistillar staminodes fide Ridley (loc. cit. [i.e., Ridley 1913]); absent from the Holotype in our observation)». Ridley (1913) makes no mention of “interpistillar staminodes”. He does make comparison of the “sterile flowers” he believed present at the base of each stamen (discussed above) with Aridarum montanum in Sarawak interpreted > the club-shaped sterile stamens (Ridley says “flowers”) associated with the pistils in most Homalomena. To Ridley this was pertinent because he supposed his Aridarum to be related to Homalomena sect. Chamaecladon. However, nowhere does Ridley use the term “interpistillar staminodes” or mention such structures to be basal to the female zone. What Ridley does say, in the protologue (here translated from the original Latin), is: “sterile flowers basal to [1.e.. at the base of the stamens]...” Apart for correcting morphological descriptive inaccuracies, access to comprehensive material, coupled with field observations, has established that uniquely for the genus the stems of 4. montanum are much elongated and somewhat branched, forming pendent masses hanging in the water flow (Fig. 1A). It may be assumed that Brooks” original collection comprised a single tuft of leaves taken from the base of one of these stem complexes. Why Brooks failed to collect more representative material is unclear. Other minor differences between the new collection and the type are that our plants have very short petioles, less than 3 mm long. The type plant has petioles up to 3 cm long, although most are much less than this, and some very short, but none as short as here recorded. Circumscription of Aridarum The morphologies noted above raise issues with the circumscription of Aridarum sensu Bogner & Hay (2000), not least the absence of an excavated stamen connective that is one of the defining morphologies for the genus Aridarum. However, pending publication of an on-going molecular study, including placement of the type species, Aridarum sensu Bogner & Hay (2000) is here retained, but with caution. ACKNOWLEDGMENTS. Research and fieldwork in Borneo was, most recently, under Sarawak Forestry Department Research Permit No. NCCD.907, 4.4(Jld.7) and Park Permit No: 104/2012. The continuing collaboration and support of the Forest Department Sarawak. and Sarawak Forestry Corporation, are gratefully acknowledged. References Bogner, J]. & Hay, A. (2000) Schismatoglottideae in Malesia II - Aridarum, Bucephalandra, Phymatarum and Piptospatha. Telopea 91): 183—194. Brooks, C.J. (1911) A trip to a source of the Sarawak River and Bengkarum Mountains. J. Straits Branch Roy. Asiat. Soc. 60: 41-51. Ridley, H.N. (1913) Some Bornean Aroideae. J. Bot. 51: 201-202. Wong, S.Y. & Boyce, PC. (2011) Lost Aroids - On the taxonomic importance of relocating poorly collected species. Malayan Nat. J. 63(4): 613-623. Digitized by ihe Internet Archive in 2014 https://archive.org/details/gazetamatematica4651 unse Gardens” Bulletin Singapore 65(1): 7-17. 2013 7 Studies on Schismatoglottideae (Araceae) of Borneo XXIII: Piptospatha colata and P. deceptrix, taxonomic novelties from Borneo P.C. Boyce! and S.Y. Wong? 'Pusat Pengajian Sains Kajihayat (School of Biological Sciences) Universiti Sains Malaysia 11800 USM, Pulau Pinang. Malaysia phymatarum(a gmail.com "Department of Plant Science & Environmental Ecology, Faculty of Resource Science & Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia sywong(4 frst.unimas.my ABSTRACT. Piptospatha colata P.C.Boyce & S.Y.Wong and P deceprrix P.C.Boyce & S.Y.Wong are newly described, respectively from Kalimantan Barat and Kalimantan Utara, Indonesian Borneo. Recognition of these novelties takes to 13 the number of described, accepted species of Piptospatha. An updated key to the genus is provided and both species are illustrated, along with those species that are most similar. Keywords. Aroid, Indonesian Borneo, Kalimantan Barat, Kalimantan Utara, Piprosparha Introduction Since the last full revision of Piprosparha (Bogner & Hay 2000) a combination of molecular and morphological research has resulted in generic changes, and recognition of a number of new taxa (Okada & Tsukaya 2010; Wong & Boyce 2010, 2012, in press; Wong et al. 2009, 2011). Major herbaria with significant tropical Asian collections (e.g., BO, L, SAR, SING) abound in specimens of unnamed rheophytic aroids. These, however, frequently defy attempts at identification owing to their incomplete nature, and frequently inadequate preparation prior to preservation. Failing attempts to recollect at original localities or, in the case of older material the distinct possibility that such localities no longer support an indigenous ecology, such material will quite likely forever remain undetermined. Given this situation, it is ironic that fieldwork and subsequent cultivation of plants from Borneo continues to reveal numerous taxonomically novel rheophytic aroid species, which should come as no great surprise given that, has been noted on numerous occasions, many aroids are highly localised. Where possible, attempts are made to match cultivated novelties with pre- existing herbarium specimens. However, often this not practicable owing to the Gard. Bull. Singapore 65(1) 2013 problems highlghted above. Two such “unmatcehable” novelties belonging to the genus Piptospatha N.E.Br. are here described. Da). Ba) 4a. Sa) Key to Piprospatha Sterile, staminodial interstice between pistillate and staminate flower zones well- defined... n cs eset aceata a a ai Saal a RI ERE RPR ORI OR RE DORI IRI 2 Sterile interstice absent, or at most defined by one or two staminodes ...... 5 Stem long, repent. (N Kalimantan ICnga)e P. repens Stem short, erect 13, cai ie a oaze era SRR o Boa NONE IRI e ea ea 3 Pistillate flowers green; spathe terminus slightly beaked but not pileate, glossy deep pink :... sine inec a aa obuze a ati a aa a a aaa e Ra NI ROI aa RR 4 Pistillate flowers pinkish grey; spathe limb strongly pileate, deep magenta- purple. (Shales; N Kalimantan iara) 3 P. pileata Staminodes rounded, convex, white. Leaf blades with primary lateral veins hardly visible abaxially. (NE Sarawak at Miri, Limbang; Brunei; W Sabah) sasa în aza atat Bf at aa alea d attata a 20700005) Rae DIORRRDNIII a a i RI P. burbidgei Staminodes prismatic, truncate, yellow. Leaf with primary lateral veins impressed. Granite. Indonesian Borneo (Kalimantan Barat: Nanga Taman) DDR PERIE po e cub ae andone aie ao era dcaaa P colata Connective extended into a pronounced elongate central beak. (? NE SarawWak). na esa sta oaza aaa ai are a RR RR E E RE E RI P. insignis Connective not raised centrally above the thecae, or at most shortly elevated and Obtuse ni ae a e er aaa o a IRI OD RE 6 Staminate.flowers pubescent E 7 Staminate. flowers plabrous.. eee 10 Spathe white at anthesis; stamen in closely-appressed, regularly-arranged pairs; leaf blades abaxially with conspicuously tessellate 2-order veins. (Malay Peninsula and southern peninsular Thailand) ............ P. perakensis Spathe pink; stamens irregularly arranged; leaf blades abaxially with 2-order veins not conspicuously tessellate, or only very faintly so. (Borneo ......... 9 New Piprospatha species from Borneo 9 9a. Diminutive plants up to 14 cm tall with decumbent-creeping stems; leaf blade elliptic, 4-6 cm long, tertiary venation abaxially forming a very faint tessellate reticulum; spadix 8-12 mm long; pistillate flower zone with 3-5 oblique whorls of staminodes at the base; fruiting spathe up 1 cm long and wide. (Plants of travertine; Kalimantan Timur: Sangkulirang) .... P manduensis b. Robust plants to 25 cm tall or more, with short, erect stems; leaf blade very narrowly oblong-elliptic, 12—20cm long, all veins parallel pinnate; spadix c. 2 cm long; pistillate flower zone fertile to the base; fruiting spathe 2.5 cm long and wide. (Plants of exposed shales; Sarawak: Kapit) ......... P. marginata 10a. Pistillate flowers bright green; spadix bullet-shaped, staminate portion bright yellow; thecae broadly excavated, the excavations of adjacent anthers forming a butterfly-shaped depression; interior of spathe tip rostrum with 5-7 conspicuous keels; persistent fruiting spathe wide-flared. (Alkaline geologies (limestone, basalt); SW Sarawak, N Kalimantan Barat) ..................... P viridistigma b. Pistillate flowers pink or dirty whitish; spadix cylindrical; staminate portion not bright yellow; thecae longitudinally sulcate with the pores ventral and dorsal to the sulcae; interior of the spathe tip rostrum with 2—3 conspicuous keels or keels absent; persistent fruiting spathe narrowly obconic. (Plants not of alkaline PELES O oroare ruta ale ela A au 0 aa pacate Se oara Il Ila. Stigmas mid-deep pink; stamen connective with smooth raised rim. (Granites; iri SATPEREL2 e cea esta 0 ED RI ERIE BRD ERROR RPR P. elongata b. Stigmas dirty whitish; stamen connective margins not smooth, rim-like. ISUS LONESIOTASIA ES) e e a aaa o o eee aa aa oală turta Ure aratat 12 I2a. Stamen connective with a triangular wing on each side; staminodes at base of pistillate zone white, rounded. (Sandstones; NW Sarawak) ....... P. impolita b. Stamen connective with frilled margins; staminodes at base of pistillate zone cream, truncate with a central depression. (Hard shales; Kalimantan Utara) a cr ucue cz cita MESERIE EDO RD 7 III RIO RI N RR 0 EERO P. deceptrix Piptospatha colata P.C.Boyce & S.Y.Wong, sp. nov. Piptospatha colata shares green pistils (or stigmas) with P. viridistiama P.C.Boyce, S.Y.Wong & Bogner and P burbidgei (N.E.Br.) M.Hotta. From P. viridistigma it may be separated by the presence of a zone of staminodes at the interstice of the pistillate and staminate flower zones, and by the staminate flowers much more densely arranged, with cream (not deep yellow) stamens, and truncate (not excavated) connectives. Piptospatha burbidgei and P. colata are distinguished from one another by truncate yellow, not convex white, staminodes at the interstice and at the base of the pistillate flower zone. Leaf morphology also serves to separate P. colata and P burbidgei; the leaf blades of P burbidgei are narrowly oblong and obtuse, with the adaxial surface smooth with the primary lateral veins almost invisible. Piprosparha colata vegetatively 10 Gard. Bull. Singapore 65(1) 2013 closely approaches P. pileata S.Y.Wong & P.C.Boyce and P deceptrrix S.Y.Wong & P.C.Boyce. From both, P colara 1s distinguished by spadix morphology. Spathe overall morphology of P colata rather resembles that of P pileata and P. elongata (Engl.) N.E.Br., although again their individual spadix morphologies distinguished them with ease. TYPE: K.Nakamoto AR-3780, Indonesian Borneo, Kalimantan Barat, Sekadau, Nangataman, west of Nangataman, Gunung Canayang east slope, 4 Feb 2012 (holo SAR! iso BO!). (Fig. 1A, 2A, 3A) Clumping rheophytic herb to 35 cm tall. Roozs strong, c. 2 mm in diameter. Stem short, condensed, to 20 mm in diameter, all except the oldest portions obscured by leaf bases. Leaves many together, spreading or arching, forming a dense rosette; petiole bases clasping stem; petiole 5-8 cm long, up to 2.5 mm in diameter, D-shaped in cross-section, minutely scabrous, dull reddish green; petiolar sheath with free ligular portion, c. 4 cm long, marcescent and ultimately deciduous, pale reddish-pink when fresh, drying dark reddish brown; leaf blades narrowly elliptic, 5—20 cm long x 24.5 cm wide, base cuneate, somewhat obtuse, apex acute with stout tubule, c. 5 mm long, in life semi-glossy medium green adaxially, paler abaxially with the mid-rib and primary lateral veins pale reddish, drying dark reddish brown with abaxial venation slightly darker; mid-rib bluntly raised adaxially, rounded-raised and minutely scabrous adaxially; primary lateral veins c. 6 per side, parallel pinnate, impressed adaxially, very slightly raised abaxially; interprimary lateral veins weaker than primary laterals although still conspicuous, interprimary veins joining a weakly defined submarginal collecting vein; primary lateral and interprimary veins very slightly raised abaxially and adaxially; interprimary veins irregularIy visible as semi-translucent broken lines running parallel to the primary laterals. Inflorescence solitary, erect; peduncle 11-15 cm long (at anthesis), c. 3.5 mm in diameter, minutely but distinctly scabrous, reddish brown. Spathe initially erect, later held at c. 90* to peduncle, later still (post anthesis) again erect, not constricted, deep pink in late bud, spathe limb opening mainly in shades of glossy deep pink, with the median keel and terminal rostrum deep purple- pink, the rostrum ultimately deep reddish brown, proximal part of spathe dull olive- greenish brown with pale speckles; spathe limb, c. 6 cm long, the base c. | cm wide, mid-way inflated to c. 2.5 cm, then ventrally constricted and terminating in a rostrum c. 6 mm long, internally without rostral keels, or with one only and these weakly defined. Spadix 2.3—2.8 cm long * 6.5—-7.5 mm in diameter, base slightly obliquely inserted onto spathe/pedunele; pistillate flower zone with 1-4 rows of rhomboidal truncate pale yellow staminodes inserted basally, pistillate flower zone jade-green, weakly barrel- shaped, 5.5—8.5 mm long * 6-7.5 mm in diameter, pistils eylindrical, truncate, very congested, c. 0.6 mm diameter; stizma weakly umbonate, papillate, as wide as ovary; pistillate and staminate zones separated by a zone c. 2 mm long comprised of c. 2 whorls of staminodes, these rhomboidal-polygonal, truncate, pale yellow; staminate flower zone cream, equalling the pistillate zone in width, 1.5-21 cm long * 6.5-7.5 mm in diameter, weakly fusiform to slightly tapering, apex blunt; staminate flowers congested, comprised of paired stamens, irregularly oblong and very weakly butterfly New Piptospatha species from Borneo IL] Fig. 1. A. Piptospatha colata P.C.Boyce & S.Y.Wong. B. Piptosparha viridistima P.C.Boyce, S.Y.Wong & Bogner. C. Piprospatha burbidgei (N.E.Br.) M.Hotta. D. Piptospatha deceptrix PC.Boyce & S.Y.Wong. E. Piprospatha pileata S.Y.Wong & P.C.Boyce. F. Piprospatha elongata (Engl.) N.E.Br. A-F. Spadices at pistillate anthesis, in each instance the spathe artificially removed. A. from AR-3665; B. from AR-250; C. trom AR-1973; D. from AR-3980; E. from AR-3923; F. from AR-3601. (Photos: Peter C. Boyce) Z Gard. Bull. Singapore 65(1) 2013 Fig. 2. A. Piprospatha colata P.C.Boyce & S.Y.Wong. B. Piprosparha viridistizma P.C.Boyce, S.Y.Wong & Bogner. C. Piprospatha burbidgei (N.E.Br.) M.Hotta. D. Piprospatha deceptrix PC.Boyce & S.Y.Wong. E. Piptospatha pileata S.Y.Wong & P.C.Boyce. F. Piptosparha elongata (Engl.) N.E.Br. A. from AR-3665; B. from AR-2432; C. from AR-1973; D. from AR- 3980; E. from AR-3923; F. from AR-3601. (Photos: Peter C. Boyce) shaped, c. 0.5 mm wide * c. | mm long, connective truncate, glabrous; thecae lateral, c. 0.3 mm, elhpsoid with a wide rim, sunken into a shallow pit. Infructescence not observed. Other specimens seen: INDONESIAN BORNEO. Kalimantan Barat. Sekadau, Sekadau Hilir, Kayu Lapis, south of Kayu Lapis „ 0”2.38'S 111*0'33.99"E, 20 Sep 2011, Nakamoto AR- 3665 (SAR); Sekadau, south east of Nanga Taman, Kampung Seri Punti, Gunung Raya, south slope, 3 Feb 2012, Nakamoto AR-3776 (SAR). Distribution. Indonesian Borneo, Kalimantan Barat, known from two localities at Nanga Taman, and a third near Kayu Lipis, c. 37 km (in a straight line) to the NE. Ecology. Obligate rheophyte on waterfalls and river boulders on granite under moist lowland forest; 100-400 m. asl. Notes. Piptospatha colata is defined by the combination of green pistils, pale yellow, prismatic staminodes, a deep pink spathe with a prominent rostrum, semi-glossy medium green leaves with primary lateral veins impressed adaxially. New Piptospatha species from Borneo | (99) Fig. 3. A. Piptospatha colata P.C.Boyce & S.Y.Wong. B. Piptospatha viridistigma P.C.Boyce, S.Y.Wong & Bogner. C. Piptospatha burbidgei (N.E.Br.) M.Hotta. D. Piptospatha deceptrix P.C.Boyce & S.Y.Wong. E. Piptospatha pileata S.Y.Wong & P.C.Boyce. F. Piptospatha elongata (Engl.) N.E.Br. A-F. Plants in habitat. A. from AR-3776; B. from AR-3669; C. from AR-1973; D. from AR-3980; E. from AR-3923; F. from AR-2052. (Photos: A & D-E, K. Nakamoto; B-C & F, Peter C. Boyce) 14 Gard. Bull. Singapore 65(1) 2013 Piptospatha colata is the third species described to have green pistils and stigmas. The others are vegetatively somewhat similar to P. viridistima P.C.Boyce, S.Y.Wong & Bogner, (alkaline geologies, NW Borneo), and the vegetatively very dissimilar P burbidgei (N.E.Br.) M.Hotta, (shales, N Borneo) (Fig. 1A-C). Piptosparha colata is distinguished from P. viridistigma by the presence of a zone of staminodes at the interstice of the pistillate and staminate flower zones, by the staminate flowers much more densely arranged, with cream (not deep yellow) stamens, and truncate (not excavated) connectives (Fig. IA & B), and the spadix barely one third as long at the spathe. Leaves of P colara difter by the combination of the relatively shorter petiole and relatively longer, narrower erect, not arching blades. Piptosparha burbidgei and P colata are difterentiated by staminode morphology and colour, with the staminodes truncate, prismatic, yellow, and not convex, rounded, white (Fig. IA & C). Leaf morphology also readily distinguishes P col/ata from P. burbidgei; leaf blades of P burbidgei are narrowly oblong, obtuse, and adaxially smooth, with the primary lateral veins almost invisible, and of a characteristically rather peculiar olive-green (Fig. 3A & C). Piptospatha colata vegetatively rather resembles P deceptrrix S.Y.Wong & P.C.Boyce and P pileata S.Y.Wong & P.C.Boyce (both from shales, Kalimantan Utara). The leaf blades of P colara are adaxially semi-glossy medium green with impressed primary lateral veins and noticeably different to matte leaf blades with only slightly impressed veins of P deceprrix (Fig. 3A & D), and the deep green, glossy blades with barely impressed venation of P pileata (Fig. 3A & E). In addition, P colata is distinguished from both by spadix morphology (Fig. IA. D& E). Spathe morphology of P colara is similar that of both P pileata and P elongata (Engl.) N.E.Br. (granites, NW Borneo—Fig. 2A, E & F), although the terminal portion of the spathe of P colata is much less pronounced-rostrate. Etymology. From Latin colatus [fem. colata], cleansed, purified, in whimsical allusion to this new species being for some time muddled by the authors with P. viridistigma, a situation rectified here. Piptospatha deceptrix P.C.Boyce & S.Y.Wong, sp. nov. Flowering Piprospatha deceptrix is reminiscent of P burbidgei, with the blunt, rose-pink spathe with short terminal rostrum almost indistinguishable. However, P deceprrix is readily distinguished from P. burbidgei by the much longer zone of truncate, centrally impressed (not weakly convex) pale yellow (not white) staminodes below the pistillate flower zone; by the absence (or at most very depauperate) interstice staminodial zone; and by the very pale pinkish grey (not green) pistils and stigmas. The narrowly elliptic, acute leaf blades with the primary lateral veins adaxially impressed are quite difterent to those of P burbidgei, in which the leaf blades are narrowly oblong, obtuse, and adaxially smooth with the primary lateral veins almost invisible. Piptospatha deceptrix most closely approaches P. pileata in overall apperance, although the latter 1s readily difterentiated by the spadix with much longer zone of yellow interstitial New Piprospatha species from Borneo 15 staminodes, by almost lacking a zone of staminodes below the pistillate flowers, and by the deep magenta-purple (not pale rose-pink) strongly pileate spathe limb. Leaves of P deceptrix and P pileata are somewhat similar, but distinguished by the leaf blades being glossy (P pileata) rather than matte (P deceprrix), and (in P. deceptrrix) the petioles lacking the crispulate hyaline wings along the dorsal edges. From both P burbidgei and P. pileata, P deceptrix 1s distinct by the stouter, blunt-tipped spadix. TYPE: Nakamoto AR-3980, Indonesian Borneo, Kalimantan Utara, Malinau Selatan, Mentarong village, near the confluence of Sungai Mentarang and Sg. Malinau, 18 June 2012 (holo SAR! iso BO!). (Fig. 1D, 2D, 3D) Clumping rheophytic herb to 35 cm tall. Roots strong, c. 3 mm in diameter. Srem short, condensed, to 25 mm in diameter, obscured by leafbases. Leaves many together, arching, forming a loose rosette; petiole bases clasping stem; petiole 5-8 cm long, up to 2 mm in diameter, D-shaped in cross-section, basal portion of petiole minutely scabrous, dull medium green; petiolar sheath with free ligular portion, 2-4 cm long, marcescent and ultimately deciduous; persistent part of ligular sheath with hyaline margin, somewhat dark reddish brown; leaf blades narrowly ellhptic to narrowly oblanceolate, 7-22 cm long * 24.5 cm wide, base cuneate, somewhat obtuse, apex acute with stout tubule, c. 5 mm long, in life matte medium green adaxially, paler abaxially, drying dull pale brown with abaxial venation darker; mid-rib bluntly raised adaxially, rounded-raised and minutely scabrous adaxially; primary lateral veins c. 8 per side, parallel pinnate, very slightly impressed adaxially, slightly raised abaxially; interprimary lateral veins weaker than primary laterals although still conspicuous, interprimary veins Joining a weaklydefined submarginal collecting vein; primary lateral and interprimary veins very slightly raised abaxially and adaxially; interprimary veins irregularIy visible as semi-translucent broken lines running parallel to the primary laterals. Inflorescence solitary, erect; peduncle 9-17 cm long (at anthesis), c. 3 mm in diameter, minutely by distinctly scabrous, reddish brown. Sparhe initially erect, later held at c. 45” to peduncle, later still (post anthesis) once again erect, not constricted, rose-pink in late bud, opening with spathe lmb bright rose-pink shading to medium pink and then pale olive-brown (base) proximally; spathe limb infiated at anthesis, shedding during staminate anthesis, c. 3.5 cm long, the base c. 1.5 cm wide, mid-way inflated to c. 2.5 cm, terminal rostrum c. 3 mm long, with 3—5 very weak internal rostral keels. Spadix 1.8—2.2 cm long * 6-7 mm in diameter, base obliquely inserted onto spathe and peduncle; pistillate flower zone with 2-4 rows of cream rhomboidal, apically impressed staminodes inserted basally, pistillate flower zone pale grey, cylindric, c. 3.5 mm long * c. $ mm in diameter, pistils cylindrical, truncate, very congested, c. 0.6 mm diameter; stigma pale grey, with a slight central depression, strongly papillate, as wide as ovary; pistillate and staminate zone mostly contiguous, occasionally with a few scattered cream staminodes between, these rhomboidal-polygonal, with a central impression; staminate zone pale cream, slightly exceeding the pistillate zone in width, c. 1.3 cm long * 6-7 mm in diameter, stoutly fusiform, apex blunt; staminate flowers congested, comprised of obscurely paired stamens, irregularly oblong, c. 0.5 mm wide x c. | mm long, connective with a weak longitudinal sulcus and slightly frilled margins, 16 Gard. Bull. Singapore 65(1) 2013 these extending around the thecae, glabrous; thecae lateral, c. 0.3 mm, elhpsoid with a wide rim, the opposite stamens linked by a the connective transverse sulcus. Fruiting spathe deeply cyathiform, dull olive-green, c. 1 cm long * 1.2 cm wide, the base obliquely inserted on peduncle. Fruits and seeds not observed. Distribution. Indonesian Borneo, Kalimantan Utara, known only from the type locality Ecology. Obligate rheophyte on waterfalls and river boulders on very hard shales under moist lowland forest; c. 200 m. asl. Notes. Piptospatha deceptrix 1s defined by the combination of lacking a zone of staminodes above the pistillate flowers, a blunt, rose-pink spathe, and matte medium green leaf blades with (abaxially) slightly impressed primary lateral veins. Inflorescences of P deceprrix are very reminiscent of those of P burbideei, with the blunt, rose-pink spathe with short terminal rostrum (Fig. 2C & D). However, P. deceptrix is readily distinguished from P. burbidgei by the much longer zone of truncate, centrally impressed (not weakly convex) pale yellow (not white) staminodes below the pistillate flower zone, the absence (or at most very depauperate) interstice staminodial zone, and the very pale pinkish grey (not green) pistils and stigmas (Fig. IC & D). The narrowly elliptic, acute leaf blades with the primary lateral veins adaxially impressed are quite different to those P burbidgei, where the leaf blades are narrowly oblong, obtuse, and adaxially smooth with the primary lateral veins almost invisible (Fig. 3C&D). In overall appearance P. deceprrix most closely approaches P pi/eata, although the latter is readily differentiated by the spadix with much longer zone of yellow interstitial staminodes, by almost lacking a zone of staminodes below the pistillate flowers, and by the deep magenta-purple (not rose-pink) strongly pileate spathe limb (Fig. ID & E; Fig. 2D & E). Leaves of P deceprrix and P pileata are somewhat similar, but distinguished by the leaf blades that are glossy (P pileara) instead of matte (P. deceptrix), and (in P. deceprrix) the petioles lacking the crispulate hyaline wings along the dorsal edges. From both P burbidgei and P pileata, P. deceptrix is distinct by the stouter, blunt-tipped spadix (Fig. IC-E). Etymology. Latin deceptus |fem. deceptrrix], to deceive, in allusion to this novelty resembling one species vegetatively, and another in floral morphology. ACKNOWLEDGEMENTS. The study visits to the herbaria mentioned in this paper were funded under the first author's ITTO Fellowship Ref. 026/09A. This is part of an on-going research which is funded by the Ministry of Higher Education, Malaysia by fundamental research grant scheme vote: FRGS/01(12)/709/2009(25). We also wish to extend our thanks to the Directors or Curators of BO, L, SAR, and SING for allowing access to material, and to their staft for facilitating our observations. New Piptospatha species from Borneo 17 References Bogner, J. & Hay, A. (2000) Schismatoglottideae in Malesia II - Aridarum, Bucephalandra, Phymatarum and Piptospatha. Telopea 91): 183-194. Okada, H. & Tsukaya, H. (2010) A new species of Piprosparha (Araceae: Schismatoglottideae) from West Kalimantan, Indonesian Borneo. Acra Phytotax. Geobot. 61: 87-92. Wong, S.Y., Bogner, ]. & Boyce, PC. (2011) Studies on Schismatoglottideae (Araceae) of Borneo XIV: Piptospatha marginata resurrected and observations on Piptospatha, notably for the Rejang drainages. Webbia 66: 29-32. Wong, S.Y., Boyce, P.C. & Bogner, ]. (2009) Studies on Schismatoglottideae (Araceae) of Borneo VIII: A review of Piptosparha elongata in Sarawak. Gard. Bull. Singapore 61(1): 217-233. Wong, S.Y. & Boyce, PC. (2010) Studies on Schismatoglottideae (Araceae) of Borneo XI: Ooia, a new genus, and a new generic delimitation for Piprospatha. Bot. Stud. (Taipei) 51: 543-552. Wong, S.Y. & Boyce, P.C. (2012) Araceae of Indomalaya II: Piprosparha N.E.Br. Malayan Nat. J. 64(1): 9-32. Wong, S.Y. & Boyce, P.C. (in press) Schismatoglottideae of Borneo XIX - Piprospatha pileata, a remarkable new species from Kalimantan Timur, Indonesian Borneo. Wi//denowia. Gardens” Bulletin Singapore 65(1): 19-26. 2013 19 Musa markkui (Musaceae), a new species from Arunachal Pradesh, India R. Gogoi! and S. Borah? Botanical Survey of India, Arunachal Pradesh Regional Centre, Senki View, Itanagar, 791111, Arunachal Pradesh, India ' rajibbsi(ayahoo.co.in (corresponding author) “souravjyotiborah(4 gmail.com ABSTRACT. Musa markkui R.Gogoi & S.Borah, a new species of Musa of the section Rhodochlamys, is described and illustrated from Lohit valley, Arunachal Pradesh, India based on observed morphological characters in the field. A key to M. markkui and related taxa is provided. Keywords. Arunachal Pradesh, banana, India, Musa, Musaceae, new species Introduction North East India is considered a part of Southeast Asia and within the centre of diversity of Musa (Musaceae), a region not studied in detail and where new species and varieties continue to be reported (Hăkkinen 2007, 2009). The genus Musa consists of about 73 species (Hăkkinen & De Langhe 2001; Hăkkinen & Sharrock 2002; Hăkkinen 2003a, b, 2004a, b, 2005a, b, 2006a-c, 2007, 2009; Hăkkinen & Meekiong 2004, 2005; Hăkkinen et al. 2005; Hăkkinen & Wang 2007; Hăkkinen & Wallace 2007; Hăkkinen et al. 2007; Hăkkinen & Văre 2008a-c; Hăkkinen et al. 2008; Swangpol & Somana 2011) and over 500 cultivars (Simmonds 1956, 1966; Champion 1967; Valmayor et al. 2001, 2002; Hăkkinen 2009). The present communication records the discovery of a new species of Musa from the Lohit valley of Arunachal Pradesh, India, here named M. markkui, which belongs to the section Rhodochlamys. The section Rhodochlamys is one of the four sections (the others being Australimusa, Callimusa and Musa) into which the genus Musa is divided, which is confined mainly to NE India, Bangladesh, Myanmar and NW Thailand (Hăkkinen 2002, 2009). Species in Rhodochlamys are characterised by erect or drooping inflorescence with fruits pointing towards the bunch apex. Most of the species typically have relatively few fruits and are best known for their brightly coloured bracts (Cheesman 1947, 1949; Simmonds 1962; Shepherd, 1999; Hăkkinen & Sharrock 2002; Hăkkinen 2005b, 2007; Hăkkinen et al. 2007). Extensive field observations were made by the senior author during four expeditions in July 2011 and September 2012 in the border areas of Lohit and Anjaw districts of Arunachal Pradesh, under the Annual Action Plan Project “Flora of 20 Gard. Bull. Singapore 65(1) 2013 Anjaw district” ot the Botanical Survey of India. The new species is described in the field following the traditional banana taxonomy approach as used by Simmonds (Simmonds 1962, 1966). Relevant portions of the specimens are deposited as holotype at the Central National Herbarium (CAL) of the Botanical Survey of India, Howrah, and isotype at the ASSAM herbarium. Musa markkui R.Gogoi & S.Borah, sp. nov. Musa markkui is closely related to M. ornata Roxb, developing slender plants, erect inflorescences, green peduncles, and pink female and male buds, but differs in developing more pseudostems per plant, a much taller height, larger leaves, inflorescences that are at first erect and later becoming horizontal, longer peduncles with whitish pubescence, revolute bracts, more hands with more fruit in the fruit bunch, and bigger fruits. TYPE: Gogoi & Borah 21654, India, Arunachal Pradesh, Lohit District, 7 km before Salangam towards Tidding, 27%56'25.33"N 96*22'38.76"E, 1302 m, 13 September 2012 (holo 3 sheets, CAL; iso ASSAM). (Fig.l & 2). Plant slender, suckers 12-22, produced freely and close to parent plant, vertical; mature pseudostem 300-325 cm tall, 9-12 cm in diameter at the base, generaily light green with blood red blotches, shining, sap milky. Peziole 483-193 cm long, 3—3.5 cm in diameter, petiole bases winged and not clasping the pseudostem, margin reddish; blade 193-240 cm long, 45-65 cm wide, margin with brownish or pinkish lining, apex truncate, upper surface deep green, lower surface light green, mid-rib on lower surface pink, on upper surface green, leaf base asymmetric, both sides rounded. I/nflorescence erect, or sometimes erect at first and then horizontal, pedunele to 40 cm long and 5.5 cm in diameter, clothed with white pubescence, sterile pink bracts two, persistent at the opening of the first female flowers. Female bud lanceolate, to 40 cm long and 8-9 cm wide; bracts pink, convolute, not waxy, white pubescent, 3-4 bracts parting at a time, revolute and deciduous. Basal flowers female, hermaphrodite, 4-7 per bract in a single row, flower 10.5 cm long (whole); ovary 5 cm long, 1.5 cm in diameter, slightly curved, triangular to quadrangular in cross section; style to 4.3 cm long, stigma capitate, 0.7 cm across; compound tepal 5.5 cm long, 2 cm wide, orange coloured, with 2 thickened keels, ribbed at the dorsal angles, with a S-toothed orange apex, lobes subequal, rolled outwards; free tepal 5 cm long, 2 cm wide, translucent yellow, ovate, with a simple told under the apex, acumen orange; stamens 5, filaments yellowish white, to 2.8 cm long, anther lobes to 3.2 cm long, rusty brown, anther and style at the same level. Male bud pink, lanceolate, to 21 cm long and Il cm wide; bracts outside pink, internally light pink to whitish, one or two bracts parting at a time, revolute and deciduous, male bud inconspicous or without remains at infructescence maturity, only the rachis remaining, 13-16 cm long. Male flowers on average 6 per bract in a row, compound tepal 3.5—5.5 cm long, 0.8—1 cm wide, golden yellow, with a S-toothed apex; free tepal 3—3.5 cm long, to 1.2 cm wide, translucent white, ovate, with a short orange acumen; style light yellow with creamy or light yellow stigma; stamens 5, filaments white, anther lobes creamy or light brown, anther and style at the same level; ovary straight, Musa markkui, new species from India 21 Fig. 1. Musa markkui R. Gogoi & S. Borah. A. Plant in wild. B. Pseudostem base. C. Emerging inflorescence. D. Inflorescence with immature fruits and male bud. E. Infructescence. (Photos: R. Gogoi & S. Borah) 22 Gard. Bull. Singapore 65(1) 2013 white, without pigmentation. Fruit brunch compact, with 4-7 fingers in a row, 7-10 hands, pedicel to 4 cm long; individual fruit up to 12 cm long (without pedicel), 2.5—3 cm in diameter, 3-4-angled, angles raised, fruit apex blunt-tipped at apex, without floral remains, fruit peel colour light greenish yellow when ripe, immature fruit pulp white, becoming creamy and soft at maturity. Seeds black, compressed, quadrangular, surface tuberculate, c. 4 mm long and Smm wide at apex. Distribution and habitat. Musa markkui is quite common în the hilly slopes of Tidding, Salangam, all the way from Hyuliang to Mataliang, at the higher elevations of 900-— 1400 m in the Lohit and Anjaw district of Arunachal Pradesh. It occurs sympatrically with M. nagensium var. hongii and M. cheesmanii Simmonds. Notes. Chromosome numbers of Rhodochlamys species are 2n=22 (Cheesman & Larter 1935; Simmonds 1962; Shepherd 1999; Hăkkinen & Sharrock 2002; Campion 1967; Hăkkinen 2009; Li et al. 2010). Etymology. The new species M. markkui is named in honour of Finnish botanist Markku Hăkkinen for his outstanding contribution to a better understanding of Musa taxonomy. There was some confusion in a horticultural context (Singh et al. 2001; Uma et al. 2005; Uma 2006: 9, Fig.7) with the name M. rosacea (non Jacquin, and used without any authority) from Arunachal Pradesh; indeed, that seems to refer to a distinct species, and shows similarity to M. markkui, but it is not published and type specimens were not deposited towards making a valid publication. On the other hand, the confusion between M. ornata Roxb. and M. rosacea Jacquin is also considered to be resolved as Jacquin's Musa is synonymous with Musa balbisiana Colla and distinct from the former (Văre & Hâkkinen 2009). NE India is very relevant to Musa taxonomy as it is the type locality of several species, viz., M. velutina H.Wendl. & Drude, M. laterita Cheesman, M. sanguinea Hook.f., M mannii H.Wendl. ex Baker, M. aurantiaca Mann ex Baker, M. cheesmanii Simmonds, M. nagensium Prain, etc. The present discovery ofa beautiful Rhodochlamys species with horticultural potential raises the possibility of further undescribed species in the wild. The new species M. markkui would be a desirable plant for introduction into horticultural cireles worldwide. Key to some closely related Rhodochlamys species la. Basal flowers female, 45 flowers per bract; male bracts orange externally, oranpe-yellow inside. e Musa aurantiaca b. Basal flowers hermaphrodite, 3—7 flowers per bract; male bracts blood red, pink-or rose on'both'sides; „e oa aero ala a a RE RER DE a Re ERP ) Musa markkui, new species from India 42, Fig. 2. Musa markkui R.Gogoi & S.Borah. A. Emerging female bud. B. Male bud with immature fruits. C. Bract with basal flowers of female bud. D. Basal hermaphrodite flower. E. Free tepal of basal flower (dorsal view). F. Free tepal of basal flower (ventral view). G. Ovary with style and stigma. H. Male flower. I. Compound tepal (ventral view) with style of male flower. J. Compound tepal (dorsal view). K. Stamens of male flower. L. Longitudinal section of fruit. M. Seeds. (Photos: R. Gogoi & S. Borah) 24 Gard. Bull. Singapore 65(1) 2013 2a. Pseudostems 2-3 in the same plant; inflorescence erect or initially erect and then horizontal; free tepals a quarter the length of the compound tepal; bracts brick red 10 TOSe: aces e e aa ae tuia pt cr a ata a N ARIEI DR RI DD RIND 3 b. Pseudostems 12-22 in the same plant, free tepals as long as compound tepals, bracis, blood reg 07 pink none e eee ovaz e ae E a 2000 a 0 RER A 3a. Pseudostem emerging 2 meters from the parent plant; inflorescence erect; male flowers 6-10 per bract in two rows, orange in colour, bracts brick red SER RR POD a cer ee Dildo dare a soedo Musa laterita b. Pseudostem emerging quite close to the parent plant; inflorescence horizontal; male flowers 2-3 per bract in one row, light yellow; bracts rose in colour înce pretur ta Tara roi arate aa aratate age IEEE ao Ie 5 RR RIDER Musamannii 4a. Plantupto 150 cm tall; inflorescence horizontal, peduncle red, bracts blood red externally and internally; fruit bunch lax 2 e Musa sanguinea b. Plant up to 250-325 cm tall; inflorescence erect, peduncle light green, bracts pink; fruit bunch compact «n e pe oa acea a oa e ei Re RR 5) Sa. Plant up to 240 cm high; pseudostem up to 15 in the same plant, with black blotches; leaves up to 200 cm long, 35 cm wide; peduncle glabrous; bracts not revolute; fruit bunch up to $ hands with 3-6 fingers; individual fruits up to 8 em long and 2'emi diaree e 2 Musa ornata b. Plants up to 325 cm high; pseudostems up to 22 in the same plant, with red blotches; leaves up to 240 cm long and up to 65 cm wide; pedunele pubescent; bracts revolute; fruit bunch up to 10 hands with 4-7 fingers; individual fruit up to 12 em long'and 3 ecua diane ler e e Musa markkui ACKNOWLEDGEMENTS. The authors are grateful to Dr. P. Singh, Director, Botanical Survey of India, Kolkata and Dr. A. A. Mao, Scientist E and HOO, Arunachal Pradesh Regional Centre, Botanical Survey of India, Itanagar for much support and logistics. We are also thankful to Dr. K.N. Gandhi, Senior Nomenclatural Registrar, HUH, Harvard, U.S.A., for his helpful suggestions during preparation of the manuscript. References Champion, J]. (1967) Les Bananiers et Leur Culture, pp. xii + 214. Paris: IFAC, Editions SETCO. Cheesman, E.E. (1947). Classification of the bananas II: The genus Musa L. Xew Bull. 2: 106-117. Cheesman, E.E. (1949) Classification of the bananas ill: Critical notes on species. Kew Bull. 3: 265-272. Cheesman, E.E. & Larter, L.N.H. (1935) Genetical and ceytological studies of Musa III: Chromosome numbers in the Musaceae. J. Gener. 30(16): 31-52. Musa markkui, new species from India 25 Hăkkinen, M. (2002) Wild bananas: The genus Musa L. of the section Rhodochlamys in India. Newslert. Bot. Surv. India 3(1): 1-3. Hăkkinen, M. (2003a) Taxonomic history and identity of Musa rubra Wall. ex Kurz. Philipp. Agric. Scientist 86(1): 92-98. Hăkkinen, M. (2003b) Musa campestris Beccari varieties in Northern Borneo. Philipp. Agric. Scientist 86(4): 424-435. Hăkkinen, M. (2004a) Musa voonii, a new Musa species from Northern Borneo and discussion of the section Cal/limusa in Borneo. Acta Phyrotax. Geobotr. 55(2): 79-88. Hăkkinen, M. (2004b) Musa campestris Becc. (Musaceae) varieties in northern Borneo. Folia Malaysiana 5(2): 81-100. Hăkkinen, M. (2005a) Musa azizii, a new Musa species (Musaceae) from Northern Borneo. Acta Phytotax. Geobot. 56(1): 27-31. Hăkkinen, M. (2005b) Ornamental bananas: Notes on the section Rhodochlamys (Musaceae). Folia Malaysiana 6(1 & 2): 49-72. Hăkkinen, M. (2006a) Musa barioensis, a new Musa species (Musaceae) from Northern Borneo. Acta Phytotax. Geobot. 57(1): 55-60. Hăkkinen, M. (2006b) Musa lawitiensis Nasution & Supard. (Musaceae) and its intraspecific taxa in Borneo. Adansonia ser 3, 28(1): 55-65. Hăkkinen, M. (2006c) A taxonomic revision of Musa rosea (Musaceae) in Southeast Asia. Novon 16(4): 492-496. Hăkkinen, M. (2007) Ornamental bananas: Focus on Rhodochlamys. Chron. Hort. 47(2): 7-12. Hăkkinen, M. (2009) Lectotypification of two Musa sections (Musaceae). Nord. J. Bor. 27: 207-209. Hăkkinen, M. & De Langhe, E. (2001) Musa acuminatra in Northern Borneo. Montpellier, France: INIBAP. Hăkkinen, M. & Sharrock, S. (2002) Diversity in the genus Musa—Focus on Rhodochlamys. INIBAP Annual Report 2001, pp 16-23. Montpellier, France:INIBAP. Hăkkinen, M. & Meekiong, K. (2004) (Publ. 2005) A new species of Musa from Borneo. Syst. Biodivers. 2(2): 169-173. Hăkkinen, M. & Meekiong, K. (2005) Musa borneensis Becc. (Musaceae) and its intraspecific taxa in Borneo. Acra Phytotax. Geobor. 56(3): 213-230. Hăkkinen, M.. Suleiman, M. & Gisil, ]. (2005) Musa beccarii Simmonds (Musaceae) varieties in Sabah, Northern Borneo. Acra Phyrotax. Geobotr. 56(2): 137-142. Hăkkinen, M. & Wang, H. (2007) New species and variety of Musa (Musaceae) from Yunnan, China. Novon 17: 440-446. Hăkkinen, M. & Wallace, R. (2007) Musa siamensis, a new Musa species (Musaceae) from Southeast Asia. Folia Malaysiana 8(2): 61-70. Hăkkinen, M., Suchânkovă, P., Dolezelovă, M., Hribovă, E. & Dolezel, ]. (2007) Karyological observations in the new variety of Musa beccarii (Musaceae). Acta Phytotax. Geobor. 58(2/3): 61-67. Hăkkinen, M. & Văre, H. (2008a) A taxonomic revision of Musa aurantiaca (Musaceae) in Southeast Asia. J. Syst. Evol. 46: 89-92. Hăkkinen, M. & Văre, H. (2008b) Taxonomic history and identity of Musa dasyearpa, M. velutina and M. assamica (Musaceae) in Southeast Asia. J. Syst. Evol. 46: 230-235. Hăkkinen, M. & Văre, H. (2008c) Typification and check-list of Musa L. names (Musaceae) with nomenclatural notes. Adansonia ser 3, 30(1): 63—112. Hăkkinen, M., Wang, H. & Ge, X.-]. (2008) Musa itinerans (Musaceae) and its intraspecific taxa in China. Novon 18: 50-60. 26 Gard. Bull. Singapore 65(1) 2013 Li, L.-F., Hăkkinen, M., Yuan, Y.-M., Hao, G. & Ge, X.-J. (2010) Molecular phylogeny and systematies of the banana family (Musaceae) inferred from multiple nuclear and chloroplast DNA fragments, with special reference to the genus Musa. Molec. Phylogenet. Evol. 57: 1-10. Liu, A.-Z., Li, D.-Z. & Li, X.-W. (2002) Taxonomic notes on wild bananas (Musa) from China. Bot. Bull. Acad. Sin. 43: 77-81. Shepherd, K. (1999) Cytogenetics of the genus Musa. Montpellier, France:INIBAP. Singh, H.P., Uma, S. & Sathiamoorthy, S. (2001) A Zentative Key for Identification and Classification of Indian Bananas. Tiruchirapalli, India: National Research Centre for Banana (ICAR). Simmonds, N.W. (1956) Botanical results of the banana collecting expedition 1954-5. Kew Bull. 11(3): 463-489. Simmonds, N.W. (1962) The Evolution of Bananas. London: Longman. Simmonds, N.W. (1966) Bananas. 2nd ed. London: Longman. Swangpol, S. & Somana, J]. (2011) Musa serpentina (Musaceae): A new banana species from Western border of Thailand. 7hai Forest Bull., Bor. 39: 31-36. Uma, S. (2006) Farmers Knowledge of wild Musa of India. Rome: FAO. Uma, S$., Sathiamoorthy, S. & Durai, P. (2005) Banana: Indian Genetic Resources and Catalogue. Tiruchirapalli, India: National Research Centre for Banana (ICAR). Valmayor, R.V. (2001) Classification and characterization of Musa exotica, M. alinsanaya and M. acuminata ssp. errans. Philipp. Agric. Scientist 84(3): 325-331. Valmayor, R.V. (2002) Classification and characterization of Musella splendida sp. nov. Philipp. Agric. Scientist 85(2): 204-209. Văre, H. & Hăkkinen, M. (2009) Proposal to conserve the name Musa balbisiana Colla against M. rosacea Jacq. (Musaceae). Taxon 58(3): 1010. Gardens” Bulletin Singapore 65(1): 27-37. 2013 27 Two new species and a new record for Colocasia (Araceae: Colocasieae) from Arunachal Pradesh. Northeast India R. Gogoi! and S. Borah” Botanical Survey of India, Arunachal Pradesh Regional Centre, Senki View, ltanagar, 791111, Arunachal Pradesh, India 'rajibdzuko(a gmail.com (corresponding author) “souravjyotiborah(a gmail.com ABSTRACT. Two new species of Colocasia (Araceae: Colocasieae), C. boyceana R.Gogoi & S.Borah and C. dibangensis R.Gogoi & S.Borah are described and illustrated from Arunachal Pradesh, NE India. Colocasia lihengiae C.L.Long & K.M.Liu is reported as a new record for the Flora of India. All three species are illustrated from living plants. A key to the Col/ocasia of India is provided. Keywords. Aroid, Arunachal Pradesh, Col/ocasia boyceana, Colocasia dibangensis, India Introduction The genus Col/ocasia Schott, includes about 20 species mainly confined to tropical and subtropical Asia (Li & Boyce 2010). One cultivated species C. esculenta (L.) Schott (taro) had tremendous economic significance since time immemorial, but taxonomically the genus is still poorly known. As a part of tropical and subtropical Asia, India is home to multiple wild species of Col/ocasia, but the full number of such species is not known, due to inadequate survey and study. While working for the “Flora of Anjaw District” under the annual action plan of the Botanical Survey of India, the authors discovered and collected three Co/ocasia species in Lohit Valley and Lower Dibang Valley district of Arunachal Pradesh. After critical study, including of the relevant literature (Schott 1854; Hooker 1893, 1900; Karthikeyan et al. 1989; Mayo et al. 1997; Li & Wei 1993; Li & Long 1998, 1999, 2000; Cao & Long 2003; Long & Liu 2001; Yin et al. 2004; Cai et al. 2006; Li & Boyce 2010), two of the species were found to be new. These are described and named here as Colocasia boyceana R.Gogoi & S.Borah and Colocasia dibangensis R.Gogoi & S.Borah. The third species has been determined as C. lihengiae C.L.Long & K.M.Liu and is presented here as a new addition for the Flora of India. Colocasia boyceana R.Gogoi & S.Borah, sp. nov. Colocasia boyceana is readily distinguished from C. fontanesii Schott (a dark purple species commonly grown as ornamental) by the dense hairy male flower zone, although 28 Gard. Bull. Singapore 65(1) 2013 both lack an appendix. Overall, C. boyceana difters from C. fontanesii by the dwarf habit and in forming massive colonies; the velvety leaf blades with venation impressed adaxially; the (frequent) presence of a conspicuous purple spot at the junction of the petiole and adaxial side of the blade; the purple blade margins; and a purple line from the blade sinus to the dorsal junction of the petiole. Co/ocasia boyceana approaches C. lihengiae C.L.Long & K.M.Liu but differs by the dense hairy male flower zone and formation of massive colonies, by the pink cataphylls to the stolons, green petiole, up to 9 pairs of leaf lateral veins, blade with purple lining along the leaf margin, purple lining of pink cataphylls in stolons, and the presence of a conspicuous purple spot at the junction of the petiole and adaxial side of blade. TYPE: India, Arunachal Pradesh, Lohit district, just crossing Udayak Pass towards Salangam, 1600 m, 27*55'59.33”N 96%21'18.48”E, 5 September 2012, Gogoi & Borah 21807 (holo CAL; iso ASSAM). (Fig. LA-C, 2) Herb, medium sized, stoloniferous. Corm subeylindric, not massive, erect or slightly horizontal, 11-17 cm long, 4-6 cm across, fusiform, much rooting, roots thick, white; szolons horizontal, non branching, light pink, with pink cataphylls, internodes cylindric. Leaves 3-6, petiole glabrous, green, 47-82 long, 0.8-lcm wide, dull green towards base, sheath to less than '£ length, bract to 32 cm long; blade ovate-cordate to sagittate-cordate, peltate, 27-40 cm long, 14-21 cm wide, velvety, glossy, dark green adaxially, pale green abaxially, with a purple spot at the ventral junction of petiole, apex acuminate or caudate; lateral veins 5-9 pairs, raised abaxially and impressed adaxially, margins with purple colouration, purple lining from sinus to junction of the petiole dorsally. Inflorescence 1, peduncle green, cylindric, shorter than petiole, 34- 43.5 long, 0.6-0.8 cm across, spathe constricted between tube and limb; tube green, oblong, 3.2-5.5 long, 1.8-2cm wide, subeylindric; limb erect, yellow on both surfaces, lanceolate, 13-16.5 cm long, apex acuminate. Spadix shorter than spathe, to 7 cm long; female zone whitish green, cylindric, c. 2 x 0.8 cm, with inter-pistillar staminodes; ovary ovate or obovoid, c. 2 mm long, 1.5 mm wide, green, stigma inconspicuously 3-lobed, sessile, disciform, translucent white, staminodes yellow, ovate, erect, c. 2 mm long and 1.5 mm wide; sterile zone yellowish white, 2.5 x 0.5 cm, eylindric; male zone c. 2.5 x 0.8 cm, synandria c. 6-androus, polygonal, creamy, with white hairs; appendix absent. Infructescence green, elliptic, 5.5-6 cm long, 2.3—2.6 cm across; berries green when young, many seeded, obovate, 6 x 5 mm, seeds many. Distribution and habitat. Colocasia boyceana grows in massive colonies in moist shady places along streams. It is so far endemic to the Lohit and Lower Dibang valley district of Arunachal Pradesh, at 1200-1600 m, recorded only by the type. The habitat 1s shared with Sfeudnera colocasiifolia C.Koch. another colocasioid. Phenology. Flowering and fruiting July-September. Etwymology. The specific epithet is given in honour of Peter C. Boyce for his outstanding contributions to the Araceae of South East Asia. pi d > = Colocasia from Northeast India 29 Fig. 1. A—C. Morphological features of Col/ocasia boyceana R.Gogoi & S.Borah. A. Habit of the plant. B. Abaxial side of the leaf purple lining in the sinus. C. Corm of the plant. D-G. Morphological features of Colocasia dibangensis R.Gogoi & S.Borah. D. Habit of the plant. E. Abaxial side of the leaf showing pink veins. F & G. Corm of the plant. (Photos: R. Gogoi & S. Borah) (99) (ao) Gard. Bull. Singapore 65(1) 2013 | Fig. 2. Habit and reproductive parts of Colocasia boyceana R.Gogoi & S.Borah. A. Habit of the plant. B. Inflorescence showing spathe and spadix. C. A complete spadix. D. Portion of the male zone showing synandria with white hairs. E. Portion of the female zone. F& G. Intructescence with green berries. (Photos: R. Gogoi & S. Borah) Colocasia from Northeast India 31 IUCN conservation status. Presently there is no perceived threat to this species. Notes. Colocasia boyceana is distinct among species of Colocasia as it bears a hairy male zone, which is the first record of such a character within the genus. This new species is close to C. fontanesii and C. lihengiae but difters significantly as discussed above. Co/ocasia fontanesii is treated here as legitimate in place of C. antiquorum (Li & Boyce, 2010) as the issue is one of typification. When Schott described C. anriguorum he intended the name to apply to a stoloniferous plant with glossy leaf blades, and a spathe limb opening almost fully and then reflexing. Unfortunately, in selecting a type he chose a sterile and incomplete Linnaeus collection that is without doubt referable to C. esculenta (hydrophobic leaf blade epidermis). Thus C. antiguorum is a synonym of C. esculenta. Given this, the next available name for the glossy-leaf plant is Schott's C. fontanesii. Colocasia dibangensis R.Gogoi & S.Borah, sp. nov. Colocasia dibangensis ditters from C. yunnanensis C.L.Long & X.Z.Cai (another Himalayan species found at similar elevations) by its reduced female zone, the lack of a constriction at the interstice, and characters of the male zone, synandria (and connective), and the synandrodes of the interstice. It is also distinctive by its purple or pink young leaves, pink veins on the abaxial blade surface, and reddish-pinkish spathe. Overall, C. dibangensis difters from C. yunnanensis by the absence of colour patches between the veins of the adaxial blade surface, the presence of purplish or pinkish colouration of the young leaf blades and petioles, pinkish veins on the abaxial surface of the blade, and the markedly more shallow sinus. TYPE: India, Arunachal Pradesh, Lower Dibang valley distict, 5 km ahead of 65 point from Mayodia towards Hunli, 28*17'40.84”N, 95*55'11”E, 2129 m, 19 Sep 2012 Gogoi & Borah 21877 (holo CAL, iso ASSAM, ARUN). (Fig. 1ID-G, 3) Herb, medium sized, tubercled. Corm erect, subglobose, 9-11 cm long, 6-8 cm across; densely rooted, roots thick, white with reddish coloration. Leaves 2-4, young leaves pinkish or reddish, old ones green adaxially; petiole pale green with pinkish or reddish colouration, cylindric, 65-80 cm long, 4-5 cm diam., sheathing is up to ' length of petiole; leaf blade cordate-peltate, orbicular-cordate, 42-75 cm long, 40-75 cm wide, membranous, apex slightly apiculate, lateral veins 7-8 pairs, raised abaxially, pink. Inflorescence 1-3 together; peduncle light pinkish, cylindric, to 17 cm, slender. Spathe constricted between tube and limb; tube reddish pink, to 5 cm long, 2.5 cm wide, oblong; limb reddish black externally, light yellow internally, subeylindric, to 13 cm long, to 2.5 cm wide, oblanceolate, margins entire, erect or slightly curved apically, apex acuminate, never relaxed on anthesis. Spadix sessile, to 17 cm long, shorter than spathe; female zone reduced, green and yellow, cylindric, to 2.3-2.5 x 1.4 cm, green fertile flowers mixed with light yellow staminodes, synandrodes broadly oblong to depressed ovate or depressed obpyramidal, apex subtruncate; ovary green, subglobose or ovoid, 1.5-2 mm diam., l-loculed, parietal, placentae 3, ovules many; stigma sessile 95) 9) Gard. Bull. Singapore 65(1) 2013 Fig. 3. Reproductive parts of Colocasia dibangensis R.Gogoi & S.Borah. A & B. Reddish- purple coloured spathe and spadix of the plant. C. Reduced female zone. D. Portion of sterile zone. E. Portion of male zone showing synandria. F. Appendix of the spadix. G. Infructescence with green berries. (Photos: R. Gogoi & S. Borah) Colocasia from Northeast India 33 or subsessile, translucent white, globose, 0.5 mm wide; sterile zone starts continually from female zone up to male zone, no constriction or slightly constricted between the zones, 22.5 cm long, to 1.3 cm wide, cylindric, synandrodes yellowish white, 2-3 mm long, 2-5 mm wide; male zone pinkish, synandria yellow with pink tinge, polygonal, 6-10-androus; appendix pink, conic, 2.5 x 0.5 cm, apex acute. Infructescence green, c. 7 cm long, 5 cm across, berry green when young, obovoid, 4-6 mm, seeds many. Distribution and habitat. Colocasia dibangensis grows in large colonies or isolated small populations in cool open places on hill slopes or along roadsides. It is so far endemic to the lower Dibang valley district of Arunachal Pradesh; elevation 1800-— 2200 m, recorded only by the type. Phenology. Flowering and fruiting July-September. Etymology. The species is named after its type locality. IUCN conservation status. Not evaluated, but while collecting we found no obvious threat to this species. Notes. Colocasia dibangensis is a species growing at high elevation and with pink or purple coloured veins abaxially. The pink-coloured spathe and pink male and highly reduced female zone (1/12th of the spadix) distinguish it from all other species of the genus. This species is with the group bearing a conspicuous appendix in the spadix, but its comparatively reduced conic appendix separates it from other species like C. esculenta, C. fallax and C. affinis which are commonly found in NE India. Colocasia lihengiae C.L.Long & K.M.Liu in Bot. Bull. Acad. Sin. 42: 313-317. (Fig. 4) Herb, medium sized, stoloniferous. Corm subglobose, not massive, erect, 3 cm in diam. Leaves 3-5, petiole glabrous, 60-100 cm long, green with purple reticulation, blade peltate, saggitate-cordate, abaxially light green, adaxially dark green, leathery, shining, 25-35 cm long, 14-21 cm wide, lateral veins 4-5 pairs, green. Inflorescences up to 5, peduncle green with purple reticulation, cylindric, shorter than petiole, 40-45 cm long, 0.7—0.8 cm across, spathe constricted between tube and limb; tube green, elliptic, subeylindric, 5.5-6.5 cm long, 1.6-2 cm wide; limb erect, golden yellow both dorsally and ventrally, ovate, 14-16 cm long, apex acuminate. Spadix sessile, shorter than spathe, to 8.5 cm long; female zone green, cylindric, 2.5-2.8 cm x 1-1.3 cm, 1/3 of the spadix, with inter-pistillar staminodes, yellow; ovary oblong, 2—2.5 x 2 mm, green, 1-loculed, placentae 2, stigma sessile, 3-lobed, disciform, white, staminodes yellow; sterile zone yellow, 2.5-3 cm x 0.8-1 cm, cylindric; male zone yellow, 3.8-4 cm x 0.7-0.8 cm, synandria 3-10-androus, polygonal, creamy, without hairs; appendix absent. Infructescence green, eliptic, 5-7 cm long, 2-2.5 cm across; berries green when young, ovate, c. 3-4 mm diam., seeds many. 34 Gard. Bull. Singapore 65(1) 2013 Fig. 4. Habit and reproductive parts of Colocasia lihengiae C.L.Long & K.M.Liu. A. Habit of the plant. B. Corm. C. Inflorescence. D. View of a complete spadix. E. Portion of the female zone showing ovaries and interpistillar staminodes. F. Portion of the male zone showing synandria and possible pollinator. G. Infructescence with green berries. (Photos: R. Gogoi & S. Borah) Colocasia from Northeast India 35 Distribution. India (Assam: Dihing Patkai Reserve; Arunachal Pradesh: road to Parasuram Kunda from Chowkham in Lohit district); China (Yunnan, Mengla, Mengxing River watershed). Habitat. Colocasia lihengiae grows in little colonies in moist forest floors of tropical evergreen forests at about 200-400 m. A quite good population was encountered in Dihing Patkai Reserve torest of Assam and on the way to Parasuram Kunda from Chowkham in Lohit district of Arunachal Pradesh. The apical shoots and petioles are sold in market as vegetable. Phenology. Flowering and fruiting July-September. Specimen examined. INDIA. Arunachal Pradesh. Between Wakro and Parasuram Kund, 250 m, 5 Sept. 2012, Gogoi & Borah 21814 (ARUN). Notes. Colocasia lihengiae was described from Yunnan province of China (Long & Liu 2001). In the F/ora of China account (Li & Boyce 2010), it was treated as a synonym of C. antiquorum. As mentioned above C. antiquorum is a synonym of C. esculenta and C. lihengiae is a distinct species from C. esculenta by the absence of an appendix, and here it is treated as a valid species. A key to the species of Colocasia is presented for NE India that includes and distinguishes C. boyceana, C. dibangensis and C. lihengiae, as follows. Key to Colocasia species in NE India (i ppeilelix present and morethan 2 cm long e oare caeieaiie e oieige oaie saeeiaie ese 2 b. Appendix absentor highly reduced, less than 1 cm long... 5 2a. Young leaves pinkish, blade 42-75 x 40-7Scm; spathe pink, tube reddish purple; spadix deep pink, appendix triangular conic ................. C. dibangensis b. Young leaves whitish green or pale green, blade less than 10-45 x 10-3Scm; spathe yellow or greenish white, or slightly purplish apically ( C. fa/lax), tube green; spadix yellow or pale yellowish green, appendix narrowly conic to e cai ai e sat 3019 ALO al OPRIRE RRC DR RE RI 0 0 RI PR RR PRIN RD 3 3a. Plant tuberous or rhizomatous, up to 100 cm tall; spathe dull yellow, spreading and open flat, not revolute; infructescence erect ....................... C. esculenta b. Plant stoloniferous, less than 75 cm tall; spathe bright yellow, not spreading, IESE SL iile scene pendenE m se aaa i arat o maina E uta alma aaa a aa ata a 4 4a. Leaves with dark patches between primary lateral veins; female and male zones e UNDA CO RIS RA N E e DO e pe A e Aaaa a ca e to Bla ua ante dlsiat C. affinis b. Leavesusually concolourous green; female and male zone separated by a zone of Ss praizi aia 7 0[0 ES a e eg date, setea BM iata dl era Boa. IND, arii e SR C. fallax 36 Gard. Bull. Singapore 65(1) 2013 Sa. Plantrobust, up to 225 cm tall; petiole and peduncle deep purple red; spathe c. 25 x llem; appendix reduced, less than lcm long ....................... C. fontanesii b. Plantsmall, less than 130cm tall; petiole green or light purple reticulate; spathe less fhan 17 7em; appendix absenti. nn 6 Ga. Leaf margin with purple lining; purple spot at ventral junction of petiole; venation impressed; synandria with white hairs ..............cneeeee C. boyceana b. Nopurple lining and spot on leaf; venation raised; synandria without hairs ...... (| Ta. Basal lobes of leaf obtuse; petiole green; spathe tube c. 2.5 cm; synandria stellately-erenate; sterile zone e 352 One e C. manii b. Basallobesofleafusually acute; petiole hght purple reticulate; spathe tube c. 5.5 cm; synandria polygonal; sterile zone c. 3 cm long ...................... C. lihengiae Coneclusion The present report establishes the existence of wild species of Co/ocasia that are shared between the western and eastern regions of Himalaya, in India and China. At the same time, it expands our understanding ofa possibly unique assemblage of diverse Col/ocasia species growing wild in NE India, composed of C. esculenra, C. boyceana, C. affinis, C. dibangensis, C. fallax, C. fontanesii, C. manii and C. lihengiae. In S China, the overall assemblage of Colocasia species also appears to be unique with C. affinis, C. bicolor, C. esculenta, C. fallax, C. fontanesii, C. gaoligongensis, C. gigantea, C. gongii, C. heterochroma, C. menglaensis, C. tibetensis and C. yunnanensis. The existence of diverse assemblages of Colocasia species in different regions of Himalaya indicates that the genus has a long and complex history in the Himalayan region. The recent discoveries of two new Colocasia species raises a posibility of the further existence of undescribed species in the wild, and at the same time the existence of more Chinese species in the region of Indian Himalaya. ACKNOWLEDGEMENTS. The authors are grateful to Dr. P. Singh, Director, Botanical Survey of India and Dr. A.A. Mao, Scientist-E & HOO, BSI, APRC for support and logistics. The first author is highly thankful to Peter C. Boyce, Sarawak, Malaysia for confirming the novelty of the species here described as C. boyceana, and to Peter Matthews, Museum of Ethnology, Japan for confirming the new status of the taxon here called C. dibangensis and for determining C. lihengiae. Thanks are also to Dr. K.N. Gandhi, HUH, Harvard, U.S.A. for helpful suggestions during preparation of the manuscript. References Cai, X.-Z., Long, C.-L. & Liu, K.-M. (2006) Colocasia yunnanensis (Araceae), a new species from Yunnan, China. Ann. Bot. Fenn. 43: 139-142. Colocasia from Northeast India 37 Cao, L.-M. & Long, C.-L. (2003) Colocasia bicolor (Araceae), a new species from Yunnan, China. Ann. Bot. Fenn. 40: 283-286. Hooker, J.D. (1893) Araceae. In: Flora of British India 6: 490-558. London: L. Reeve & Co. Hooker, J.D. (1900) Col/ocasia antiquorum var. fontanesii. Curtis s Bot. Mag. 126 (ser.3.v.56): (i, 7/]/32 Karthikeyan, S$.. Jain, S.K., Nayar, M.P. & Sanjappa, M. (1989) Monocotyledonae. In: F/orae Indicae Enumeratio. P. 10. Calcutta: Botanical Survey of India. Li, H. & Boyce, P.C. (2010) Colocasia. In: Flora of China 23. Pp. 73-75. Beijing: Science Press: St. Louis: Missouri Botanical Garden Press. Li, H. & Long, C.L. (1998) A preliminary revision of Araceae in China. Acra Bot. Yunnan. Supp. 10: 12-23. Li, H. & Long, C.L. (1999) A new species of Co/ocasia (Araceae) from Mts. Gaoligong, China. Feddes Repert. 110: 423-424. Li, H. & Long, C.L. (2000) Colocasia gongii (Araceae), a new species from Yunnan, China. Feddes Repert. 111: 559-560. Li, H. & Wei, Z.X. (1993) Colocasia heterochroma, a new species of Colocasia from Araceae. Acta Bot. Yunnan. 15: 16-17. Long, C.L. & Liu, K.M. (2001) Colocasia lihengiae (Araceae; Colocasieae), a new species from Yunnan, China. Bor. Bull. Acad. Sin. 42: 313-317. Mayo, $.J., Bogner, J]. & Boyce, P.C. (1997) The Genera of Araceae. U.K.: Royal Botanic Gardens, Kew. Schott, V. (1854) Pflanzenskizzen. In: Oesterreichischesbotanisches Wochenblatt 4(51): 409-— 410. Yin. J.-T., Li, H. & Xu, Z.-F. (2004) Colocasia menglaensis (Araceae), a new species from southern Yunnan, China. Ann. Bot. Fenn. 41: 223-226. Ti în A Gardens” Bulletin Singapore 65(1): 39-46. 2013 39 Zingiber kangleipakense (Zingiberaceae): A new species from Manipur, India Rajkumar Kishor! and Jana Leong-Skornitkovâ? 'Medicinal Plants and Horticultural Resources Division, Institute of Bioresources and Sustainable Development, Takyelpat Institutional Area, Imphal-795001. Manipur, India “The Herbarium, Singapore Botanic Gardens. 1 Cluny Road, 259569 Singapore jana_skornickova(4seznam.cz ABSTRACT. Zingiber kangleipakense Kishor & Skornick. (Zingiberaceae) from Manipur, India is newly described and illustrated. A comparison with the most closely related species, Z. longiligulatum and Z. roseum is provided. Keywords. Gingers, NE India. taxonomy, Zingiber longiligulatum, Zingiber roseum, Zingibereae Introduction The genus Zingiber Mill. (Zingiberaceae, Zingibereae) is distributed in tropical to warm-temperate Asia with the highest diversity in the monsoonal parts of Asia. particulariy in Thailand with 56 species (Triboun 2006) and China with 43 species (Wu & Larsen 2000). The exact number of species in the genus is not known. More than 250 names in Zingiber have been published, but this probably corresponds to about 100 to 150 species (Theilade 1999; Wu & Larsen 2000). Key characteristic features of the genus Zingiber include i) lateral staminodes fused to the labellum, ii) labellum not connate to the filament, iii) elongated, horn-like anther crest, wrapped around the style and 1v) presence of a pulvinus at the base of the petiole, which distinguishes Zingiber from other ginger genera in the field even when sterile. Roxburgh reported 11 species of Zingiber in India (1810, 1820). Later, Baker (1892) described 24 species from British India. Of these, only 16 fall within Indias current boundaries. In the checklist of Indian monocots, Karthikeyan et al. (1989) listed 18 species, eight of which were reported by Sabu (2003, 2006) from South India. There is no recent work on the genus Zingiber from N or NE India. Inspite of some 60 new Zingiber taxa described in past twenty years from China (e.g. Tong 1987; Tong & Xia 1987, Tong & Liu 1991, Fang & Qin 1996). Vietnam (Theilade & Mood 2000), Thailand (e.g. Theilade 1999; Mood & Theilade 2002), Peninsular Malaysia (Theilade 1998; Lim 2001a.b, 2002, 2003), Borneo (Theilade & Mood 1997, 1999) and Philippines (Mood & Theilade 2001), no new Zingiber has been reported from India or Bangladesh recently. 40 Gard. Bull. Singapore 65(1) 2013 While exploring in NE India, the first author found a Zingiber species growing quite abundantly in moist and shady areas of the Imphal valley in July 2000. It could not be matched to any Indian, Chinese, Thai or Indochinese species, nor to the protologues of the vast majority of other Zingiber species. Type specimens of the most closely related species have been examined at BK, BKF, CAL, HTBC, KUN, MH & P. The new Zingiber is thus described below. The measurements and descriptions provided are based on living material. The plant parts were photographed using a digital camera, while dissected materials were directly scanned using a flatbed scanner (Model: 2300c, Hewlett Packard), micro details were photographed using a stereo-zoom microscope (Model: SZ-II, Olympus, USA). Zingiber kangleipakense Kishor & Skorni&k., sp. nov. Zingiberi roseo similis, robustiore (ad 1.7 m longo contra 0.9 m), bracteis viridibus (contra rubellis), corollae lobis luteis (contra clare rubris), antherae crista lutea (contra aurantiaca) differt. TYPUS: Kishor 9, India, Manipur, Imphal, Sagolband, c. 24*48'N 93*55'E, 780 m asl, 20 July 2000 (holo CAL; iso SING; iso Herbarium of Institute of Bioresources and Sustainable Development, Imphal). (Fig. 1 & 2) Terrestrial rhizomatous herb, rhizome branched, mature branches up to 2.0 cm in diam., externally lhght brown, internally white when young, white to pale cream when old, with mild turmeric aroma. Leafy shoot 150-170 cm tall, erect, fleshy. Leaf sheaths green or with reddish tinge, glabrous or finely pubescent, with thin membranous margins; ligule 2—3.2 x 1.3-1.5 cm, slightly, unequally bilobed at apex when young, more or less entire later, glabrous, hyaline and fragile. Leaves 8-15 per pseudostem, sessile or shortly petiolate; petiole 0-5 mm long; lamina 35-42 x 7-8 cm, oblong- lanceolate, adaxially dark green, smooth, pubescent along side of midrib, abaxially oft-green, pubescent, base cuneate, apex acuminate. Inflorescence generally arising from the rhizome on a separate short peduncle 0.5-1 cm, sometimes breaking through the leaf-sheaths up to 25 cm above the ground. Spike 5-8 x 3-4 cm, narrowly ovoid, bearing 15-20 flowers. Braczs 2.8-6.5 x 1.8—3.5 cm, outer 3-4 bracts oblong, apex rounded, green or tinged with purplish red, inner ones oblong-lanceolate, pale green, apex reflexed, cuspidate, shortly hairy, margins hyaline. Bracteole 3.8-4.3 x 0.8 cm, lanceolate, shortly pubescent on the outside, margins thin, membranous, cream coloured. Calyx c. 2.5 x 0.5 cm, tubular, white, membranous, tri-dentate with 1 cm longitudinal unilateral incision, pubescent. Floral tube slender c. 5 cm long, pale yellow to white towards the base, dorsal corolla lobe 2.5—3.0 x 0.4—0.6 cm, translucent cream at the base, deep yellow with reddish tinge at apex, strongly recurved; lateral corolla lobes c. 2.5 x 0.5 cm, coloured as the dorsal lobe, recurved, adhering basally to the ventral surface of the labellum at 1.2 cm from the apex. Label/lum c. 3 x 1.5 cm, light yellow with wavy and crisped margins, side lobes absent or reduced to a 1 mm long, triangular vestige. Anther sessile, thecae 1.8 cm long; connective and crest Fig. 1. Zingiber kang IKEHS A. Rhizon IC WIiu h roots. B. Pseudostems. C. Ligules. D. Apex and base of the leaf. E. Inflorescence. F. Bracts. G. Bracteole. H. Single flower (side view, calyx removed). |. h uri th = + (£ Ai nther with crest (f Labellum Toni VIew) 4 j (Haitened) L,. O Vary seeds. 0. Seeds embedded in aril. Scale bars: A. C. E—K, of the floral tube. N. Mature fruit with l, M-N (1 cm); B (50 cm). D (5 cm in XS i! = = zi 1 attane Q Dorsal and lateral corolla lobes (flattened). K. J - 7 L ra Îs rs n d | >pigvnous elands. M. Ovary with calyx and base shor 9. (Photos: Rajkumar Kishor) 42 Gard. Bull. Singapore 65(1) 2013 yellow. Pollen 277 x 158 um, ovoid. Style 7.5 cm long, filiform, stigma projecting from the anther crest, ostiole hairy. Epigynous glands two, 4 mm long, free from each other, cream. Ovary c. 4 x 3-4 mm, trilocular with many ovules, placentation axile, densely pubescent outside. Fruir a capsule, 4 x 2.5 cm, ovoid-elliptic, trigonous, green with red tinge outside, bright red inside; seeds up to 6 mm long, black, obovoid, completely covered in white aril. Distribution, habitat and ecology. The species is known to occur in at least three districts of Manipur, namely Imphal West, Imphal East and Sanapati. It grows at 750-— 1400 m above sea level in Imphal Valley usually in the undergrowth of groves and bamboo brakes, prefering moist and shady areas. It may be found cultivated around homesteads too. The prevailing climate in the valley is monsoon sub-tropical with an annual rainfall of 1375 mm and a temperature range of 12—27*C. Phenology. Flowering June-July, fruiting August-September. Etwwmology. The specific epithet is assigned in honour of Kangleipak, an old name of Manipur, which is the natural habitat of Z. kangleipakense. This area provides and important contribution of plant and animal species to the Indo-Burmese biodiversity hotspot. Vernacular names and uses. In Manipur, it is locally known as “Namra”. Young rhizome along with the pseudostem are sold on local vegetable markets in Imphal and neighbouring villages and are used as a minor vegetable by cooking with fermented fish, potato and other items in a preparation commonly known as “iromba”. Notes. Zingiber kangleipakense is similar to Indian Z. roseum (Roxb.) Roscoe from India (Roxburgh 1798, 1820). Both species have thick, fleshy, white to pale cream rhizomes, shortly petiolate leaves of similar size and shape, inflorescences arising from the rhizome on a short peduncle embedded in the ground and single-lobed yellow labellum. The lamina of more robust Z. kangleipakense, is, however, pubescent abaxially on the sides of the midrib, has green and broader bracts, yellow corolla lobes and a yellow anther crest. Z. kangleipakense is similar also to Chinese Z. longiligulatum S.Q.Tong, but the latter reaches only up to 1 m, has larger leaves, narrower bracts, patent dorsal corolla lobe and orange anther crest. More detailed comparison of characters among Z. roseum, Z. longiligulatum and Z. kangleipakense is presented in Table 1. Triboun (2006) pointed out the difficulties in placing Z. junceum and Z. barbatum at infrageneric level as these species produce inflorescence both basally and terminally fitting into section Zingiber and Dymezewiczia respectively. For similar reasons, it is difficult to place Z. kangleipakense unequivocally in a section. Although the shape of the labellum and the inflorescence borne directly from the rhizome resemble numerous species of section Cryptanthium), the inflorescence of Z. kangleipakense sometimes protrudes through the pseudostem, a characteristic known from section P/ewranrhesis. This species was previously misidentified as Amomum aromaticum by Singh et al. (2003). New Zingiber from Manipur, India 43 Fig. 2. Zingiber kangleipakense. A. Leafy shoot. B. Infructescence with mature, opened fruit. C. Infructescence with closed, not fully matured fruit. D-E. Inflorescence breaking through the leaf-sheaths of pseudostem. F. Infiorescence emerging from the rhizome at the ground level. Based on Kishor 9. (Photos: Rajkumar Kishor) 44 Gard. Bull. Singapore 65(1) 2013 Table 1. Comparison of characters of Zingiber kangleipakense with Z. roseum and Z. longiligulatum, the latter two as observed from original descriptions, original illustrations and types. Character Z. kangleipakense Z. longiligulatum Z. roseum Rhizome white to pale cream not described white internally internally Leafy shoot 150-170 cm 80-—100 cm 60-90 cm Ligule 2-—3.2 cm long, entire or 4-5 cm long, entire, not mentioned bilobed, glabrous pubescent Lamina 35-42 x 7-8 cm, midrib 43-49 x 10-11 cm, 30 x 8-10 cm, sides pubescent abaxially pubescent abaxially both sides glabrous Peduncle up to | cm when arising 2-6 cm not specified; short, from the rhizome, rarely up to c. 5 cm based protruding through the on drawing pseudostem up to 25 cm above ground. Bracts 2.8_6.5X 1.8-3.5cem, 44.5 x 0.8-0.9 cm, reddish outer 2-3 green with green, pubescent, apex purplish red tinge, inner acuminate green, apex cuspidate, cusp hairy Floral tube white to pale yellow, yellowish at apex, white to pale yellow glabrous densely pubescent Corolla yellow with reddish tinge yellowish, dorsal bright red, dorsal lobes terminally, dorsal corolla corolla lobe patent corolla lobe strongly lobe strongly reflexed reflexed Labellum entire, single-lobed or with entire, single-lobed, entire, single-lobed, rudimentary side lobes, yellowish, side lobes light yellow unspotted, light yellow absent Anther crest light yellow orange orange ACKNOWLEDGEMENTS. The first author thanks the Director, IBSD, Imphal for extending the laboratory facilities for the study. We thank the curators of BK, BKF, CAL, HTBC, KUN, MH, P herbaria for letting us examine specimens in their care. The Zingiberaceae Resource Centre at the Royal Botanic Garden Edinburgh (http://elmer.rbge.org.uk/zre/) and the Asian Zingiberaceae Resource Centre at Singapore Botanic Gardens are acknowledged for providing New Zingiber from Manipur, India 45 protologues, related references and images of numerous type specimens. We are grateful to Dr. J.F. Veldkamp (L) for translating the diagnosis into Latin. References Baker, J.G. (1892) Zingiber. In: Hooker, J.D. (ed) Flora of British India 6: 243-249. London: L. Reeve and Co. Fang, D. & Qin, D. (1996) Five new species of monocotyledonae from Guangxi. Guihaia 16: 3-8. Karthikeyan, S., Jain, S.K., Nayar, M.P. & Sanjappa, M. (1989) Zingiberaceae. In: Florae Indicae Enumeratio - Monocotyledonae. Pp. 289-299. Calcutta: Botanical Survey of India. Lim, C.K. (2001a) The *Firebird”: A resplendent new Zingiber from Peninsular Thailand and Malaysia. Folia Malaysiana 2: 35-42. Lim, C.K. (2001b) The scented Zingiber wrayi Prain ex Ridley: A new variety. Folia Malaysiana 2: 43-53. Lim, C.K. (2002) A new endemic species of Zingiber Boehm. from Johor, Malaysia. Folia Malaysiana 3: 25-30. Lim, C.K. (2003) Zingiber aurantiacum (Holtt.) Theilade, Z. petiolatum (Holtt.) Theilade and two related new taxa from Peninsular Malaysia and Thailand. Folia Malaysiana 4: 65-— 76. Mood, ]. & Theilade, 1. (2001) Two new species of Zingiber (Zingiberaceae) from the Philippines. Nord. J. Bor. 21: 129-133. Mood, ]. & Theilade, 1. (2002) New gingers from Southeast Asia. Vew Plantsman |: 14-22. Roxburgh, W. (1798) Plants of the Coast of Coromandel. Vol. 2. London: W. Bulmer & Co. Roxburgh, W. (1810) Description of several of the monandrous plants of India. Asiar. Res. Il: 318-362. Roxburgh, W. (1820) Flora Indica. Serampore: Mission Press. Sabu, M. (2003) Revision of the genus Zingiber in South India. Folia Malaysiana 4: 25-52. Sabu, M. (2006) Zingiberaceae and Costaceae of South India. Kerala: Printarts Oftset. Singh, H.B., Singh, R.S. & Sandhu, J.S. (2003) Herbal Medicine of Manipur: A Colour Encyclopaedia. New Delhi, India: Daya Publishing House. Theilade, 1. (1999) A synopsis of the genus Zingiber (Zingiberaceae) in Thailand. Nord. J. Bor. 19: 389-410. Theilade, 1. (1998) Revision of the genus Zingiber in Peninsular Malaysia. Gard. Bull. Singapore 48: 207-236. Theilade, 1. & Mood, J]. (1997). Five new species of Zingiber (Zingiberaceae) from Borneo. Nord. J. Bot. 17: 337-347. Theilade, |. & Mood, J]. (1999) Five new species of Zingiber (Zingiberaceae) from Borneo. Nord. J. Bot. 19: 513-524. Theilade, 1. & Mood, J]. (2000) Validation of Zingiber collinsii (Zingiberaceae) from Vietnam. Nord. J. Bot. 20: 32. Tong, S.Q. (1987) New plants of Zingiber from Yunnan. Acta Phytotax. Sin. 25: 140-149. Tong, S.Q. & Liu, X.Z. (1991) A new species of Zingiber from Yunnan. Acta Bor. Yunnan. 13:27-29. Tong, S.Q. & Xia, Y.M. (1987) New taxa of Zingiberaceae from southern Yunnan. Acta Phytotax. Sin. 25: 460-471. 46 Gard. Bull. Singapore 65(1) 2013 Triboun, P. (2006) Biogeography and Biodiversity of the Genus Zingiber in Thailand. PhD thesis submitted to the Graduate school, Khon Kaen University, Thailand. Wu, T.L. & Larsen, K. (2000) Zingiberaceae. In: Wu, Z.Y., P.H. Raven (eds) Flora of China 24: 333-346. Beijing: Science Press. Gardens” Bulletin Singapore 65(1): 47-95. 2013 47 The history and identity of Boesenbergia longiflora (Zingiberaceae) and descriptions of five related new taxa John D. Mood!, Linda M. Prince?, J.F. Veldkamp* and Santanu Dey* "Lyon Arboretum, University of Hawaii, 3860 Manoa Road, Honolulu, HI 96822, USA zingiber(4/warmlava.com “The Field Museum, Department of Botany, 1400 S Lake Shore Dr., Chicago, IL 60605, USA National Herbarium of The Netherlands, Naturalis Biodiversity Center, P.O. Box 9514. 2300 RA Leiden, The Netherlands “Department of Botany, Nagaland University, Lumami 798627, Zunheboto, Nagaland, India ABSTRACT. The history of Boesenbergia longiflora (Wall.) Kuntze (Zingiberaceae) is reviewed, iis identity is discussed and a lectotype designated. Five new, related taxa are described and illustrated: B. collinsii Mood & L.M.Prince, B. hamiltonii Mood, S.Dey & L.M.Prince. B. kerrii Mood, L.M.Prince & Triboun, B. kingii Mood & L.M.Prince, and B. maxwellii Mood, L.M.Prince & Triboun. A phylogenetic analysis of plastid rnă intron (including mark) and nuclear ITS DNA sequence data indicate these Boesenbergia species form a clade within Boesenbergia. Results of the molecular data analyses in concert with several diagnostic characters, support the recognition of the new taxa. Historical illustrations, colour plates, a field key to the species, a comparative table, a listing of the botanical history of B. longiflora, and a geographical distributional map are provided. Keywords. Burma, Curcumorpha, Gastrochilus, India, Thailand Introduction Boesenbergia longiflora (Wall.) Kuntze was described in 1829 as Gastrochilus longiflora by Nathaniel Wallich based on his collection from Rangoon, Burma [Wa/lich 65894 (K-W)]. Boesenbergia was proposed in 1891 when Otto Kuntze observed that Gastrochilus Wall. is a homonym of Gastrochilus D.Don (1825; Orchidaceae). In 1974 it was regarded as belonging to the monotypic genus Curcumorpha A.S.Rao & D.M.Verma. This change was countered by Larsen (1997) but is still in use by some (Kress et al. 2002, Gao et al. 2004). During a botanical survey in the Lampang Province, Thailand in 1998, numerous plants which at first were identified as B. /ongiflora were observed growing on the margins of secondary forest. These were easily recognised by their robust stature and large, white flowers. Later, another Boesenbergia, reminiscent of B. longiflora, but with yellow flowers, was encountered on a limestone outcrop [Mood & Pedersen 1455 (C)]. 48 Gard. Bull. Singapore 65(1) 2013 Its specific identity remained unclear. Several years later, yet another Boesenbergia with yellow flowers was collected by Mark Collins (1963-2011) from a limestone area in Loei Province, Thailand. Living plants of this field collection (7-3068) were later determined to be similar to the earlier Lampang collection. Identification of the two collections began with a review of Wallich's description of G. /ongiflora which was described as having small, yellow flowers with red markings on the labellum (Fig. 1). This information was very surprising, as it was inconsistent with the current perception of B. longiflora being a ginger with large, white flowers with pink markings on the labellum (Wu & Larsen 2000; Kress et al. 2002; Gao et al. 2004, 2005; Larsen & Larsen 2006). This significant discrepancy precipitated a complete review of the history of B. /longiflora (Appendix A). The historical findings indicated that the true B. /ongi/lora (Wall.) Kuntze was very similar to the two aforementioned Thailand collections. The current perception of a white-flowered ginger appears to have been fostered by a watercolour published by Hooker in 1843 (Fig. 2). Based on a reference by Baker (1890), the plant Hooker used for this illustration was sent to Kew from the Calcutta Botanical Gardens (Wallich 1840), which was identified with the unpublished name, G. jenkinsii. Although Baker (1890) mentioned this error, he described white flowers, as did Schumann (1904). Holttum (1950) also noted the discrepancy between the Hooker illustration and Wallich's, but did not pursue the matter. Rao and Verma (1974) described their C. longiflora as white-flowered, but in this case, it was based on 20 specimens from Assam and Meghalaya, India, the area where Wallich found G. jenkinsii (Voigt 1845). Although the historical information improved the taxonomic understanding of B. longiflora, several taxa remained unconfirmed or unidentified: Wallich's G. jenhinsii from Assam (Fig. 2); the large white-flowered Boesenbergia common to N. Thailand; the specimens cited by Rao and Verma; and finally, the two yellow-flowered Thailand collections. In order to properly identify these and other specimens, the present research was initiated in 2008 using an integrated taxonomic/phylogenetic approach. Materials and methods Taxonomy. Historical references, both text and illustrations (Appendix A) were used to provide an understanding of past taxonomic perceptions. Also, over 200 digital images of B. aff. longiflora obtained from various sources were reviewed and categorised by flower morphology and geographic location, providing early clues on diversity and phytogeography. Herbarium specimens (75) labelled as B. /ongi/lora or C. longiflora were examined and photographed at ASSAM, BK, BKF and CAL in 2009. Another 75 specimens were viewed via digital images from AAU, C, E, K, L, P, SING and US. This exercise provided an important finding—the B. /ongiflora complex was extremely difficult to sort out and distinguish one taxon from the other in the herbarium. Vegetative characters often used to determine the identity of dried specimens in other Zingiberaceae were not particularly useful here. Additionally, flowers did not preserve well, changed colour upon pressing and became indistinguishable by shape. Boesenbergia longiflora and related taxa 49 poa Mia? coluonleie, PL: eee droga, had, A Lp Ani /7 Ad. / Ma Li Fig. 1. Gastrochilus longiflora (B. longiflora). Watercolour on paper by Vishnupersaud (1829) from the Wallich Collection, Kew. Reproduced with permission of The Board of Trustees of the Royal Botanic Gardens, Kew. 50 Gard. Bull. Singapore 65(1) 2013 To determine which taxon a B. aff longiflora specimen belonged, the location, habitat, plant height, flower colour and underground morphology were important. Here, the “Additional specimens examined” under each described species are determined based on a combination of these parameters. The name B. /ongiflora (see “Taxonomy” below) is lectotypified. During 2008-2012, c. 25 live rhizome divisions of B. aff. longiflora were obtained from a variety of sources: botanical gardens, research institutions and various personal collections. Each accession was grown by the first author in Hawaii, USA under controlled, shade-house conditions. Details on the morphology and phenology were recorded over several growing seasons. DNA samples with a corresponding herbarium specimen were taken from each accession. In 2009-2012 field observations were made in Thailand with botanists from BK, the Thailand Institute of Scientific and Technological Research and Kasesart University. Similarly in India, observations were conducted with personnel from the Botanical Survey India (Shillong), the Assam Forestry Department and the Nagaland University. Digital images of all Boesenbergia observed in the field and in cultivation were recorded for later reference. Early in the research, all Boesenbergia species known to have radical inflorescences were evaluated for possible inclusion in the B. /ongi/lora complex. Based on molecular data (Mood et al., unpublished) B. basispicata K.Larsen ex Sirirugsa, B. tenuispicata K.Larsen and B. trangensis K.Larsen belong to other Boesenbergia clades. DNA samples were not available for B. angustifolia (Haller f.) Schltr., B. phyllostachya (Gagnep.) K.Larsen and B. siphonantha (King ex Baker) M.Sabu, Prasanthk. & Skorni€k. Consequently, their phylogenetic position is undetermined at this time. The final taxonomy presented here represents an incorporation of data from the phylogenetic analyses, field observations and detailed study of the cultivated plants. The descriptions are ordered with the yellow-flowered species first, followed by the white-flowered species. The distribution map (Fig. 20) was constructed by mapping types and selected specimens of each species (these are marked by an asterisk following the herbarium abbreviations in the list of additional specimens examined). Molecular phylogeny. Phylogenetic analyses were conducted to complement and assist in taxonomic decisions required to elucidate relationships among species of the B. longiflora clade as defined here. Taxon selection was based on an unpublished broader analysis of plastid înăK data for Boesenbergia relative to other genera of Zingiberaceae (authors in prep.). The bulk of the data for non-Boesenbergia samples are from the earlier family-wide analyses of Kress et al. (2002) with a few additional sequences from recently described genera such as from Kress et al. (2010) and Leong- Skornickovă et al. (2011). The data for the specimens cited in these references can be tound at http://www.ncbi.nlm.nih.gov/genbank/ (GenBank 2011). A representative shortest maximum parsimony (MP) phylogram is shown in Fig. 3. Only names of relevant Boesenbergia samples are indicated on the phylogram. Boesenbergia longiflora and related taxa 5) ş e î m 7 1044 Pi d d dy is aaeomol Essec Apr L15'£ Pitch dA” Pub du $ Curtis ua A Fig. 2. Hand-coloured lithograph published in Curtis's Botanical Magazine 69, t. 4010, 1843 as Gastrochilus longiflora. Reproduced with permission of The Board of Trustees of ihe Royal Botanic Gardens, Kew. (Identified by Baker (1890) as G. jenkinsii. Described here as B. hamiltonii.) 52 Gard. Bull. Singapore 65(1) 2013 DNA was extracted from silica-dried leaf material or leaf tissue from herbarium specimens using standard methods as described in Kress et al. (2002). Thirty-seven samples of Boesenbergia were used in the DNA sequencing analyses. Two samples of B. pulcherrima (Wall.) Kuntze, the generic type, were designated as outgroup taxa. Two other samples, B. plicata var. lurida (Radl.) Holttum and B. plicata var. plicata (Ridl.) Holttum were also included. The remaining samples were all members of the B. longiflora clade. All samples were designated by a collection or accession number and vouchered (Appendix B). Both nuclear and plastid data were collected. The nuclear ribosomal ITS (nrlTS) region was amplified using the 18S-F and 26S-R primers (Prince 2010) and Phusion high fidelity polymerase (New England BioLabs, Ipswich, Massachusetts, USA) with 5X GC Buffer per the manufacturer's instructions at an annealing temperature of 62*C. The same primers were used for subsequent sequencing. The plastid pnK region was amplified and sequenced using conditions described in Kress et al. (2002) or Prince & Kress (2006). Two newly designed primers were synthesized to assist with sequencing of some difficult samples (SFb: CTCTATGGATTTTICAAGGAT and SRb: AGACCAAAATGAAAATAATA). All samples were direct sequenced on a 3130x1 Genetic Analyser at Rancho Santa Ana Botanic Garden (Claremont, California, USA). Noisy sequences (electrophoregrams showing more than a few polymorphic sites) in the nrITS data were cloned using TOPO TA cloning kits (Invitrogen, now Life Technologies, Grand Island, New York, USA) with four to eight clones sequenced per sample. A small number of the 7rnK sequences were also noisy (due to polymerase “stutter” caused by a mononucleotide T repeat around 450bp). Those samples were re-amplified using Phusion polymerase, which has been shown to outperform other polymerases for this particular problem (Fazekas et al. 2010) and re-sequenced. Individual sequences of each specimen were edited and a consensus sequence was generated in Sequencher v4.9 (Gene Codes Corporation, Ann Arbor, Michigan, USA). The consensus sequence was trimmed (18S and 26S data pruned from the ITS1+5.8S+1TS2 region, removal of amplification primer sequences from the 7rnă region) exported and aligned manually in Se-Al v2.0a11 (1996; available from A. Rambaut, Oxford, England, UK at http;//tree.bio.ed.ac.uk/software/seal). Alignment was relatively straightforward due to the high degree of sequence similarity and length for the taxa involved. Ambiguous regions were generally restricted to the monomeric “T” repeat in the 5” irnĂ—matk intergenic spacer (IGS). All newly generated data have been deposited in GenBank and are available under accession numbers JX992748-— JX992840 (Appendix B). Data were analyzed under parsimony and likelihood criteria by genomic data partition, first independently, and later in combination. The decision to combine data partitions is often based upon the results of an incongruence-length difference, or ILD test (Farris et al. 1995). We did not perform this test as it has been suggested to be too conservative (Cunningham 1997, Struck 2007). We expected the test to fail due to the presence of two very different ITS copies detected for at least one sample in the ITS data partition. The decision to combine data partitions was instead based on a combination of tree topology congruence and branch support values. In most instances Boesenbergia longiflora and related taxa 53 Boesenbergia clade Boesenbergia longiflora clade | Boesenbergia plicata Craniffia. Kedhalia. Newmania Cornukaempferia Font Kaempferia Cati Zingiber ——— hlamys Pit meu Curcuma, Hitchenia, Smithatris, Stahlianthus EI jLarsenianthus 'ommereschea Globba. Mantisia, and Caulokaempferia Hemiorchis | Renealmia ii Aframomum Amomum, Elettariopsis and Paramomum Gagnepainiă =Uipinia pro parte Alpinia pro parte Etlingera, Hornstedtia, Plagiostachys, Vanoverberghia | Pleuranthodium, Reidelia, Burbidgea iligugmom iamanthus amijia — 5 changes Fig. 3. One of many shortest maximum parsimony phylograms (simplified) for Boesenbergia and other representatives of Zingiberaceae based on plastid 1rnK data analysis, rooted using Siphonochilus ].M.Woods & Franks as suggested by Kress et al. (2002). The position of the genus Boesenbergia, the B. longiflora clade and the taxa sampled for this study are indicated. * indicate branches with MP Bootstrap values >50%. S4 Gard. Bull. Singapore 65(1) 2013 tree topologies were consistent between data partitions. In cases where tree topology diftered, branch support for the conflicting topology was reviewed. If branch support was weak (<65% BS, <0.95 PP) the data for those taxa were analysed in combination. As stated above, the ITS data for one taxon included two very different copies. In another instance, there was strong positional conflict among the nuclear and plastid phylogenies for one sample. Disparate copies were included in all individual data set analyses, but only one copy was included in combined data analyses. The ITS copy retained for combined analyses was selected to best match to the chloroplast phylogeny. Maximum parsimony and maximum likelihood (ML) analyses were conducted in PAUP* (version 4.0b10, Swoftord 2002). Heuristic search methods were conducted in each case with 1000 random addition replicates for MP and 10 random addition replicates for ML, each with tree bisection and regrafting (TBR) branch swapping. Maximum Parsimony analyses were conducted under Fitch parsimony criteria (Fitch 1971). Maximum likelihood analyses were conducted using model parameters selected by jModelTest (version 0.1.1 available at http://darwin.uvigo.es; Posada 2008, Guindon & Gascuel 2003) under both the Akaike Information Criterion (AIC; Akaike 1974) and the Bayesian Information Criterion (BIC; Schwarz 1978). All Maximum Likelihood trees were saved. Both AIC criterion and BIC criterion models were analysed for all data partitions, but only the trees from the AIC analyses will be discussed as both methods produced nearly identical trees. Branch support was estimated using parsimony bootstrap (BS) in PAUP* and posterior probabilities (PP) in MrBayes v3.2.1 (Ronguist & Huelsenbeck 2003). MrBayes analyses were conducted through the CIPRES portal (Cyberinfrastructure for Phylogenetic Research; Miller et al. 2010) and used partitioned data whenever appropriate (partitions = 5'irnK IGS + 3'irnk IGS, mark, ITS) and were run in triplicate to ensure convergence. Bootstrap values were based on 1,000 pseudoreplicates, each with 100 random addition replicates, TBR branch swapping, saving a maximum of 10 trees per random addition replicate and hold=4 trees. The number of generations necessary to estimate posterior probabilities varied depending upon the dataset and the time required to reach stasis (average standard deviation of the splits frequency =0.01). Results and discussion A number of exploratory analyses were conducted to evaluate the consistency of the phylogenetic hypotheses generated by the different data partitions. As stated above, some of the data generated from the nuclear ribosomal partition were noisy, indicating the presence of divergent ITS copies within a sample. Although it is not common, multiple copies of ITS have been detected in a number of genera and species of Zingiberaceae including Al/pinia (Liu et al. 2009), and Cornukaempferia (L. Prince pers. obs.), and multiple ITS copies per individual is prevalent in Curcuma (Zâveskă et al. 2012) and Kaempferia (L. Prince, pers. obs.). The presence of multiple, strikingly ditterent copies can be explained by a number of different evolutionary histories, a Boesenbergia longiflora and related taxa SE) few of which are presented here. The ITS region is present in hundreds (or thousands) of copies, often on multiple, different chromosomes. Processes affecting the utility of ITS for phylogenetic reconstruction were reviewed by Alvarez & Wendel (2003) including a discussion of the processes described below. One explanation for the detection of multiple different copies in one organism is that the multiple copies were present in the ancestor and those copies are being maintained through time. Another explanation is recent genetic drift of some copies due to relaxed evolutionary constraints. Given the importance of this region for the functionality of the organism, it would not be likely unless there has been duplication (perhaps due to polyploidisation). Chromosome counts have not been made for the sample of B. longiflora (Kress 03-7305, US) included here, so perhaps this is a plausible explanation. Yet another possibility is recent gene flow between closely related taxa. If hybridisation happened in the recent past, there is a possibility that the two different copies have not yet had the time to undergo concerted evolution. If this process is incomplete, each parental copy will be recovered and, in a phylogenetic analysis, the different copies would each cluster with one of the (putative) parents. Alternatively, chimeric ITS sequences might be detected. No matter the source of multiple, different copies ofITS present within any given organism, there is ample indication that most organisms undergo concerted evolution of the ITS region, a process by which the different copies are homogenised across the genome resulting in a single (or at least dominant) copy per organism. The length of time for complete homogenisation of the ITS of any given organism is unknown and likely highly variable. Although there has been a great deal of speculation regarding concerted evolution and homogenisation in purported hybrid taxa of flowering plants, our best understanding of the actual time required is gleaned from experiments with artificial hybrids (e.g., Armeria: Fuertes Aguilar et al. 1999, Feliner et al. 2001; Hieracium: Mrăz et al. 2011) and in recently derived polyploidy taxa (e.g., Spartina: Ainouche et al. 2004; Helictotrrichon: Winterfeld et al. 2009; Oryza: Ying et al. 2010). Nuclear ribosomal ITS data The aligned data matrix included 86 potentially parsimony-informative characters (43 for ingroup only). As indicated above, several samples required cloning to obtain clean ITS sequences. Two other samples, indicated by an asterisk in Fig. 4, should be cloned to clarify a few polymorphisms. Maximum parsimony analysis produced over 100,000 shortest trees and could not be run to completion. One of the 37 shortest ML trees is shown in Fig. 4. The ML phylogram presented in Fig. 4 identifies a moderately supported clade that includes all samples of B. kerrii and B. collinsii plus one ot the B. longiflora clones (88% BS; 1.00 PP). Both B. kerrii and B. co/linsii are resolved as monophyletic with moderate to strong support. The other ingroup clade is moderately to strongly supported (75% BS; 0.98 PP), and includes all samples of B. kingii, B. hamiltonii, B. maxwellii and two clones of B. longiflora. Resolution within the clade is poor and internal branches are generally poorly supported although most of the B. kingii samples and clones cluster together with 70% BS and 1.00 PP. 56 Gard. Bull. Singapore 65(1) 2013 B. kingii MIIP47 Cl B. kingii MI1P47 C2 B. kingii M11P47 C3 B. kingii MI1P47 C4 B. kingii M11P47 C5 B. kingii M3019 C10 B. kingii M3074 C2 B. kingit M3074 C3 B. kingii M3074 C8 B. kingii M3019 C3 B. kingit M2002 C2 B. kingii M3020 CI2 „ kingii M3074 C4 B. kingii M3074 C7 B. kingii MI1P78 B. kingii M3015 C3 B. kingii M3019 C6 B. kingii MO8P161 B. kingii M3015 C4 B. kingit M3015 C13 70/1.00 B. kingii M3020 C8 B. kingii M3015 Cl B. kingii M3015 CI B. kingii M3019 Cl B. kingii M3019 C8 B. longiflora M11P48 C1 B. longi ora M11P48 C6 B. kingii Il (ez) B. kingii k97-5821* B. rd M11P47 C6 B. hamiltonii M301 B. hamiltonii M3026 B. hamiltonii M3212 B. maxwellii M11C132 S mon ep NI i M002 C3 „kingii M2 7510.98 B. kingiM3015 (Ge) B. maxwellii M2032 B. maxwellii M2040 B. maxwellii MP 1450 B. maxwellii M11P26 100/1.00 B. maxwellii M11P124 B. maxwellii M2017 B. collinsii M2010 Bi. Colt MRI 483 . collinsii 100/1.00 d A coli MOL „collinsii 88/1.00 B. kerrii M2058 74/.| 75/0.92]| ! B. kerrii M3009 B. kerrii M2044 0 B. kerrii SEI ia: pe . longiflora 100/1.00 B. plicata subsp. ic alea, 3177 B. plicata Sute, urida M3120 100/1.00 B. pulcherrima K98-6220 B. pulcherrima M08P276 0.005 substitutions/site Fig. 4. One of 37 best, Maximum Likelihood phylograms (-ln=2218.749) for Boesenbergia longiflora and closely related taxa based on analysis of nuclear ribosomal ITS data for all samples and clones. Support values (Bootstrap/Posterior Probability) for critical branches are shown above branches. Bold typeface highlights strongiy supported positions of the different Boesenbergia longiflora copies generated by cloning. Asterisks indicate samples that should also be cloned to clarify a few polymorphisms. Underlined samples are placed in conflicting positions on the chloroplast phylogeny. Note: lower branches were pruned to fit page and are not to scale. Boesenbergia longiflora and related taxa 57 B. collinsii M2010 B. collinsii M2011 65/0.94 B. collinsii MP1455 B. collinsii MO6P14 61/0.90 B. collinsii M3035 63/0.94 ui B. kerrii M2044 B. kerrii M2049 B. kerrii M2058 B. kerrii M3009 B. maxwellii M2017 B. maxwellii M2032 B. maxwellii M2040 99/1-00_| p maewellii M11P26 B. maxwellii M11P124 B. maxwellii M11C132 B. maxwellii MI1C133 B. longiflora M11P48 98/1.00 B. kingii K97-5821 B. kingii MO8P161 B. kingii M11P47 B. kingii M2002 B. kingii M3015 B. kingii M3019 63/0.83 B. kingii M3020 B. kingii M3074 B. kingii M3272 88/1.00 B. kingii MILP78 B kingii MLLP77 B. hamiltonii M3026 B. hamiltonii M3017 65/0.85 95/1.00 100/1.00 99/1.00 B. plicata lurida M3120 B. plicata plicata M3177 B. pulcherrima M08P276 B. pulcherrima K98-6220 —— 0.0005 substitutions/site Fig. 5. Single best Maximum Likelihood phylogram (-ln=3953.067) for B. longiflora and closely related taxa based on analysis of chloroplast 7rnK intron data. Support values (Bootstrap/ Posterior Probability) for critical branches are shown above branches. Numbers in bold typeface indicate strong support. Underlined samples are placed in confiicting positions on the nuclear ribosomal phylogeny. Note: lower branches were pruned to fit page and are not to scale. 58 Gard. Bull. Singapore 65(1) 2013 The identification of at least two disparate ITS copies for B. longiflora requires further discussion. Only one sample of B. /ongi/lora was available for inclusion in this study. This sample, M//P468 was from cultivated plants grown by the first author, but originally collected in Burma (Kress 03-7305, US). Multiple clones representing one B. /ongiflora ITS type were distributed among members of the B. kingii clade (ITS copy “A”) while the other B. /ongi/lora copy fell sister to the B. kerrii clade (ITS copy “B”) as is shown in Fig. 4. Although a number of tests have been proposed to distinguish between the processes of hybridisation and incomplete lineage sorting (Joly et al. 2009) all have limitations. We were restricted here by the single sample for B. longiflora, but hopefully, more samples will be available for future analyses. The majority of the polymorphic samples were identified as B. kingii based on morphology. Six of the twelve samples required cloning to generate clean ITS sequences. These samples fall into two categories. The first group included samples with multiple ITS sequence types, but those sequences were all quite similar with only a few different bases or slight length variations. Analyses of the ITS data partition placed all of these sequences in the B. kingii sensu lato clade as described above (B. hamiltonii + B. kingii + B. maxwellii), and with moderate to high support (75% BS, 0.98 PP) but with poor resolution within the clade (Fig. 4). Further, most of the B. kingii samples clustered with moderate support (70% BS, 1.00 PP). Among the ingroup members, B. kingii is the most broadly distributed species and is the most genetically diverse taxon. Chloroplast trnK intron (including the protein coding matK gene) A total of 36 potentially parsimony-informative characters (15 for ingroup only) were used to generate almost 100,000 maximum parsimony trees. However, maximum likelihood analyses resulted in a single best tree (Fig. 5). The lkelihood tree had a topology identical to several of the MP trees. As with the results of the ITS analyses, both MP and ML analyses identified two clades within the ingroup, one including samples of B. collinsii + B. kerrii + B. longiflora + B. maxwellii (65% BS; 0.85 PP) and a clade comprising B. hamiltonii and B. kingii (63% BS; 0.83 PP). Three taxa were resolved and supported as monophyletic: B. col/linsii (65% BS, 0.94 PP) B. kerrii (63% BS, 0.94 PP) and B. maxwellii (99% BS, 1.00 PP). The relationship of B. maxwellii to B. hamiltonii and B. kingii diftered here relative to the ITS results, but only with weak (65% BS; 0.85 PP) support. Sequences for two samples were not available for this data set, B. hamiltonii M3212 and B. maxwellii MP1450. The two samples with names underlined in Fig. 4, B. kingii M/1P77 and MI1P78, were identical and clearly supported as members of the B. kingii group in the phylogeny produced by analyses of the nuclear ITS dataset. Results of the chloroplast data analyses (Fig. 5) clearly (88% BS, 1.00 PP) placed these two samples in a clade with B. hamiltonii. Combined analyses The combined data set required a number of samples to be excluded. Because the ITS data required cloning for some samples, results of the ITS MP analyses were used to select the clone with the shortest branch for each sample (as suggested by Beilstein et Boesenbergia longiflora and related taxa 59 al. 2008) for subsegquent use in the combined analyses. This was done only when all clones for a particular sample either formed a monophyletic lineage or clustered within a moderately or well-supported lineage (BS>75%). In the instance of B. kingii samples MIIP77 and MI1P78, there was positional conflict between the nuclear and plastid datasets. Those samples were excluded from the combined analysis. As mentioned, there was only a single sample of B. longiflora available for this study. The nuclear data set included two distinctly different copies, A and B. Rather than totally exclude this critical taxon, we selected the nuclear copy B that best matched the chloroplast phylogeny, while recognising we do not know which better represents the evolutionary history of the species. Maximum parsimony analysis produced 468 shortest trees. Maximum likelihood analyses produced three equally likely trees, one of which is shown in Fig. 6. Both MP and ML analyses identified two clades within the in-group most similar to those of the ITS data analyses, a B. kingii clade including samples of B. hamiltonii + B. kingii + B. maxwellii and a B. longiflora sensu lato clade including samples of B. collinsii + B. kerrii + B. longiflora. The B. kingii sensu lato clade received 62% BS and 0.78 PP. Unlike the ITS data analyses results, the combined data analyses produced highly resolved topologies within this clade. Significantly, B. maxwellii is resolved as monophyletic (83% BS; 1.00 PP). Boesenbergia hamiltonii and B. kingii samples are grouped together with 51% BS and 0.95 PP. Boesenbergia hamiltonii was also resolved as monophyletic, but with weak support (<50% BS, 0.86 PP). The B. longiflora sensu lato clade was strongly supported (95% BS; 1.00 PP) with significant internal structure and support. Boesenbergia collinsii was supported as monophyletic (100% BS; 1.00 PP) as was B. kerrii (93% BS, 1.00 PP). The single sample of B. longiflora was sister to B. kerrii (64% BS, 0.64 PP). but this placement should be viewed with caution. Multiple accessions for each taxon (except B. longiflora) were included to assess genetic variation within and among the newly identified taxa. The amount of sequence variation within each taxonomic clade was generally less than the amount of variation between clades as is shown by the phylograms in Figs. 4-6. Despite the higher level of sequence diversity within B. kingii, it is supported as monophyletic. The results of both maximum parsimony and maximum lkelihood analyses of DNA data presented above consistently identified five mostly strongly supported clades within the B. /ongiflora complex: B. collinsii, B. hamiltonii, B. kerrii, B. kingii and B. maxwellii. The data also support two sister relationships, one between B. collinsii and B. kerrii, and one between B. hamiltonii and B. kingii. The position of B. longiflora and B. maxwellii are less clear. The relationship of B. longiflora to these taxa is uncertain due to polymorphism în the nuclear (ITS) data set, but it is clearly closely related to them. Boesenbergia maxwellii jumps between the two clades depending upon data set examined. Finally, additional data are needed to test between various hypotheses (incomplete concerted evolution due to genetic drift post polyploidisation, hybridisation, or incomplete lineage sorting) to explain the high level of genetic variation detected in the nrlTS of B. kingii. Overall, although there are a number of questions remaining, the molecular data allowed for the delineation of six taxa. 60 Gard. Bull. Singapore 65(1) 2013 B. kingii M2002 B. kingii M3074 B. kingii MO8P161 B. kingii MIIP47 B. kingii M3015 B. kingii M3272 89/1.00 B. kingii M3019 B. kingii M3020 51/0.95 B. kingii K97-5821 B. hamiltonii M3017 B. hamiltonii M3026 B. hamiltonii M3212 62078] 79% B. maxwellii M2032 B. maxwellii M2040 B. maxwellii MP1450 B. maxwellii M11P26 83/1.00 B. maxwellii M11P124 B. maxwellii MIIC132 B. maxwellii MLIC133 B. maxwellii M2017 B. collinsii M2010 B. collinsii MP1455 B. collinsii M2011 B. collinsii MO6P14 B. collinsii M3035 95/1.00 B. kerrii M2058 93/1.00 B. kerrii M3009 B. kerrii M2044 B. kerrii M2049 64/0.64 B. longiflora MI1P48 100/1.00 B. plicata lurida M3120 B. plicata plicata M3177 100/1.00 100/1.00 100/1.00 B. pulcherrima K98-6220 B. pulcherrima MO8P276 — 0.0005 substitutions/site Fig. 6. Single best Maximum Likelihood phylogram (-ln=5747.386) for B. longi/lora and closely related taxa based on analysis of combined chloroplast /rnă intron and nuclear ribosomal ITS data. Support values (Bootstrap/Posterior Probability) for critical branches are show above branches. Numbers in bold typeface indicate strong support. Boesenbergia longifiora and related taxa 61 Taxonomy A field key to the Boesenbergia longiflora clade of species as elucidated above is provided here (see also Table 1.) Key to six species in the Boesenbergia longiflora alliance la. Flowers light yellow to bright, darker yellow ...............mcmc ceas 2 EEE lowers pure White 10 creamy White .......mmc-ae came poe o deea oa one aa saadlaula a daealaia - 2a. Plants c. 50-80 cm., leaves broad, some horizontal, thecae red (Thailand) ac oua a 3 cr a 0 ea E IRRD IRI III RR II ORI B. collinsii 3a. Flowers small, c. 2.5-3.0 cm, very saccate, staminodes light yellow, throat red maculate, labellum medium yellow, apex entire, thecae white (Burma) = aeaa a da aie ot Da 08 co A RET RPR IRI RR B. longiflora b. Flowers larger, c. 3.5-4.0 cm, saccate, staminodes very light yellow to white, throat red-orange, maculate, labellum streaked with red, apex truncate, thecae 2 re Îi 7 7 0 Co NE ete CI El Ta ) INDORE RE BIR E RR B. kerrii 4a. Rhizomes many, running, cylindrical, c. 5-15 mm diameter, flowers white to creamy white, throat red, sometimes with pink apex (NE India, Burma, SW Dar re uri 20 at 8 0 O RR NE PRR RR IRI RR IRON RR B. kingii b. Rhizomes few, small, with vertical tuberous roots c. 16 cm long .................. 5 Sa. Labellum apex light pink, throat red (NE India)... B. hamiltonii b. Labellum light and dark pink, throat orange, very frilled, crisped, large flower Era i inaland Lao: PR)... cec ce ame da starea B. maxwellii Enumeration of species Boesenbergia longiflora ( Wall.) Kuntze, Revis. Gen. Pl. 2: 685 (1891). — Gastrochilus longiflorus Wall., Pl. Asiat. Rar. |: 22, t. 25 (1829) (“longiflora”). — Curcumorpha longiflora (Wall.) A.S.Rao & D.M.Verma, Bull. Bot. Surv. India 13: 339 (1974), pro comb. LECTOTYPE (designated here): Wal/lich 65894 (K, IDC microfiche 7394, digital image seen) Burma, Rangoon. (Fig. 1, 7, 17 & 19A). Deciduous herb up to | m tall; rhizome small, irregularly shaped, c. | cm diam., externally brown, internally light yellow to white; multiple, small bulb-lke rhizomes 62 Gard. Bull. Singapore 65(1) 2013 ri 4 TI — maria . Cl 4% PF D Fig. 7. Boesenbergia longiflora (Wall.) Kuntze. A. First-day flower. B. Second-day flower. C. Plants. D. New rhizomes and tuberous roots. A-D, M//P48. (Photos: ]. Mood) Boesenbergia longiflora and related taxa 63 surrounding the main rhizome, c. | cm long, pink or white; tuberous roots two or more, c. 8 x 0.5 cm, tapering to a tuber, c. 2 x | cm, externally white or pink, internally white, root hairs few, c. 20 mm long, thin, white. Pseudostem up to c. 30 cm long, composed of leaf sheaths, base c. 2-2.5 cm diam., 1-2 short leafless sheaths at the base, leaf sheaths c. 10-16 cm, longitudinally ridged, green, glabrous, margin hyaline. Leaves 5-8 per pseudostem; petiole 9-18 cm, deeply channelled, green, glabrous; ligule slightly bilobed, lobes an extension of the hyaline margin, 2 mm long, slightly acute, protruding outward, green, glabrous; lamina ellptical or broadly ovate, c. 41- 61 x 20-21 cm, plicate, ventrally dark green, glabrous, dorsally lighter green, glabrous with a few hairs on the midrib, base rounded to cordate, sometimes asymmetric, apex acute to long acuminate. Inflorescence radical, c. 3-4 per pseudostem, up to c.12 cm long (including peduncle) produced from the side of the rhizome, pedunele c. 1-3 cm long, white, glabrous, basal sheaths 1-2, pink and white, glabrous; spike horn-shaped, 5-10 x 1-2 cm. Braets cymbitorm, 3-4, c. 5-6 x 1.5 cm, distichously arranged, red and green, glabrous, each bract enclosing one flower, some basal bracts sterile, apex sometimes curved; bracteole cylindrical, c. 5 x 0.5 cm, white, translucent, glabrous, open to the base, apex acute. Flowers 2-3 per inflorescence, up to c. 11 cm long. Calyx tubular, 20 x 5 mm, white, translucent, glabrous, apex bi-dentate. Floral tube 10 cm long, c. 3 mm wide at the base, white, glabrous externally and internally, corolla lobes (dorsal and ventral) linear to lanceolate, c. 2 x 0.5 cm, yellowish-white, glabrous, margins involute; androecial tube cup-shaped, c. 4-5 mm long, c. 7 mm diam. at the top, yel!lowish-white, glabrous externally and internally. Label/lum saccate, semi- orbicular, 2.2-2.5 cm long, 2.0-2.2 cm wide (when flattened at broadest point) light yellow, throat centre dark red, maculate with yellow showing through as dots, red pattern broadening to the lip apex, glabrous, margin wavy or wrinkled, revolute on the sides, apex elongate, emarginate; lateral staminodes obovate, 1.3 x 1.0 cm, light yellow, glabrous, apex rounded. Stamen 8 mm long, filament | mm long, 2 mm wide at base, light yellow, few short glandular hairs, anther 7 mm long, 2 mm wide (first day) then 5 mm wide (thecae diverging on the second day) apex rounded with no anther crest, thecae c. 7 x | mm, white, dehiscing along the entire length. Ovary c. 7 x 3 mm, trilocular, axile placentation, white, glabrous; szyle filiform, white, glabrous, stima rounded, white, ostiole transverse, without cilia, exuding a sticky liquid on the second day; epigynous glands linear, two, 4 mm long, light yellow. Fruiz not seen. | Measurements based on living, cultivated material of M//P46, originating from Kress 03-7305 (US)]. Distribution. So far known only from two locations in Burma (Fig. 20). Ecology. Collected in the understorey of a primary teak forest [Aress 03-7305 (US)]. More observations are needed in Burma to fully document the ecology. Phenology. Flowering from May to September with a two-day flowering cyele for each flower. 64 Gard. Bull. Singapore 65(1) 2013 Etwmology. Latin, longus = long and flos = flower. Named by Wallich for the long flower. Notes. The cultivated material (M//P45) was grown from dormant rhizome divisions of Kress GH2003-051 cultivated at the Smithsonian Institution, and originally collected on 18 June 2003, in Rakhine state, Burma as Kress 03-7305 (US). This accession compared very well with Wallich's description and watercolour (Fig. 1). The only exception was the lack of pigmentation on the lower lamina surface, a character found to be highly variable throughout this clade. Of note are the very small, bulb- like rhizomes which develop en masse, underground, at the base of the pseudostem. Each of these small entities are loosely attached to the main rhizome and if separated can produce a new plant. Wa/lich 6989B (CAL, K, microfiche 7394) annotated and listed as G. /ongiflora (Wallich 1832) has a terminal inflorescence and as such, appears to be a different taxon, perhaps related to B. siphonantha (King ex Baker) M.Sabu, Prasanthk. & Skorni€k. Boesenbergia kerrii Mood, L.M.Prince & Triboun, sp. nov. Boesenbergiae longiflorae (Wall.) Kuntze affinis, inflorescentiis 4 vel plus floribus, floribus maioribus 3.5-4.0 cm longis c. 2.8 mm latis, labello elongatiore truncato apice indentato differt. TY PUS: Mood & Triboun 12P170, Cultivated in Hawaii, USA, | Nov 2012 (holo BK; iso AAU). Originally from Thailand, Tak Province, Khao Pa Wo District, near Mae Sot, c. 600 m asl, 16”48.783'N 98*39.70'E, 8 September 2010, Mood & Triboun 2044, cultivated as M2047. (Fig. 8, 9, 17 & 19B) Deciduous herb up to 1.2 m tall; rhizome small, globular, c. | cm diam., externally red, pink or light tan, internally light yellow to white; multiple, small bulb-like rhizomes surrounding the main rhizome, c. | cm long, pink turning red with age; tuberous roots few to numerous, c. 12 x 0.5-0.8 cm, tapering to a point, externally and internally white, root hairs few, c. 10 mm long, thin, white. Pseudostem up to 30 cm, composed of leaf sheaths, base oval, c. 2-2.5 cm diam., 1-2 leafless sheaths at the base, leaf sheaths longitudinally ridged, green, glabrous, margin hyaline. Leaves 5-8 per pseudostem; petiole 9-18 cm, deeply channelled, green, glabrous; lgule slightly bilobed, lobes an extension of the hyaline margin, 2 mm long, green, glabrous; lamina elliptical or broadly ovate, c. 41-61 x 20-21 cm, plicate, ventrally dark green, glabrous, dorsally lghter green, glabrous with a few hairs on the midrib, base rounded to cordate, sometimes asymmetric, apex acute to long acuminate. Inflorescence radical, c. 3-6 or more per pseudostem, up to c. 15 cm long (including peduncle) produced from the side of the rhizome; peduncle c. 1-4 cm long, white, glabrous, basal sheaths 1-2 , pink and white, pubescent; spike horn-shaped, 5-12 x 1-2 cm. Bracts cymbiform, 4-6, c. 4-5 x 1.5-2 cm, distichously arranged, green and red, glabrous, each bract enclosing one flower, some basal bracts sterile, apex sometimes curved; bracteole cylindrical, c. 5 x 0.5 cm, white, translucent, glabrous, open to the base, apex acute. Flowers 3-6 Boesenbergia longiflora and related taxa 65 Fig. 8. Boesenbergia kerrii Mood, L.M.Prince & Triboun. Ink line drawing with watercolour of the type plant by Linda Ann Vorobik (2012). 06 Gard. Bull. Singapore 65(1) 2013 Fig. 9. Boesenbergia kerrii Mood, L.M.Prince & Triboun. A. First-day flower of M2044. B. Second-day flower of M 2044. C. Plants of M2049. D. Rhizomes and tuberous roots of M2058. E. Typical habitat on limestone with bamboo. (Photos: ]. Mood) Boesenbergia longiflora and related taxa 67 per inflorescence, up to c. 15 cm long. Calyx tubular, 2.0 x 0.5 cm, white, translucent, glabrous, apex bi-dentate. Floral tube 12-14 cm long, c. 3 mm wide at the base, white, glabrous; corolla lobes (dorsal and ventral) linear to lanceolate, c. 2 x 0.5 cm, white to light yellow, glabrous, margins involute; androecial tube cup-shaped, c. 4-5 mm long, c. 10 mm diam. at the top, yellow, glabrous externally and internally. Label/um saccate, semi-orbicular, 3.8-4 cm long, 2.2 cm wide (when flattened at the broadest point) light yellow, throat centre orange-red, maculate with yellow showing through as dots, red pattern broadening toward the lip apex, ending c. 10 mm short of the apex, then dark red streaks to the apex, glabrous, margin entire, revolute on the sides, apex shortly to deeply bilobed, 2-8 mm, slightly wavy; lateral staminodes obovate, 1.3 x 1 cm, light yellow, glabrous, apex rounded, revolute, margin wavy. Sfamen || mm long, filament 2 mm long, 2 mm wide at the base, light yellow, with a few short glandular hairs, anther 9 mm long, 3 mm wide (first day) then 6 mm wide (thecae diverging on the second day) apex rounded with no anther crest, thecae c. 9 x | mm, light yellow, dehiscing along the entire length. Ovary c. 8 x 4 mm, trilocular, axile placentation, white, glabrous; szyle filiform, yellowish-white, glabrous, sfizma round to oval, white, ostiole oval, without cilia, exuding a sticky liquid on the second day; epigynous glands linear, two, 5 mm long, light yellow. Fruiz not seen. (Measurements based on living, cultivated material of M2044). Distribution. This species is prevalent in western Thailand from the southern area of Tak Province to the southern area of Kanchanaburi Province. It should be expected in E. Burma. Ecology. This species has been found only in close proximity to limestone rock outerops. In almost all situations observed, the primary canopy component was bamboo with mixed deciduous, hardwood species. The plants grow in the cracks between limestone rocks where there is accumulation of organic matter or in deeper soils surrounding the limestone karsts. In the dry season these areas are often burnt, leaving a biochar residue. Shade is variable from light to medium. Plants commonly occur as single individuals, but over time, can create small populations of scattered plants. The result is a group of separate stems growing close together or scattered about. Phenology. Flowering from June to October with a two-day flowering cyele for each flower. Erwmology. Named in honour of Arthur F.G. Kerr (1877-1942) one of the “founding fathers” of botany in Thailand. His two specimens from the Thailand/Burma border (1922) appear to be the first collections of this new taxon. Additional specimens examined: THAILAND. Tak Province. Umphang, Kao Hua limestone hills, 13 Jun 1922, Kerr 6133 (P, C; *); South of Mae Sot along Maenam Moei, 17 Jun 1922, Kerr 6144 (K. L, P; *); Khao Pha Wo, 23 Jul 1973, Murata, Fukuoka & Phengkhlai T-16947 (BKF); Khao Pha Wo, 23 Jul 1973, Murata, Fukuoka & Phengkhlai T-16949 (BKF, KYO, 08 Gard. Bull. Singapore 65(1) 2013 L); Mae Sot Dist., 20 Aug 1994, Maxwell 94-911 (BKF). Kanchanaburi Province. Tha Sao Dist., 14 Sep 2010, Mood & Chalermglin 2049 (BISH; *);, Huai Kayeng Dist., 15 Sep 2010, Mood & Chalermeglin 2058 (BISH; *), Sai Yok, 16 Sep 2010, Mood & Triboun 3009 (BISH; *); Sai Yok, 100 m, Aug 1928, Marcan s.n.(C, K); Ka Tha Lai, Fan Faung River Valley, 25 km east of Wangka, 1 Jun 1946, Kostermans 787 (AAU, BO, C, L, P; *); Sai Sok Falls, 30 Jun 1963, Larsen 10349 (AAU; *); Dong Yai Ban Ka Kwang, 14 Aug 1971, Phengkhlai 2959 (AAU, BKF); Thong Pa Phum, 5 Jul 1973, Maxwell 73-109 (AAU; *), Sai Yok, Marcan s.n. (C, K); Thong Pha Phum, Zriboun 27 (BK; *); Huay Ban Kao to Kritee, 4 Jul 1973, Geesink & Phengkhlai 6088 (BKF, L). Notes. Boesenbergia kerrii 1s similar to B. longiflora, but the former has a more exserted, longer floral tube, broader, longer lip with a truncate apex, different labellum colour pattern and rectangular throat opening. When habitats are compared, B. kerrii is found only on or around limestone, while the type of B. longiflora and the specimen, Kress 03-7305 (US) appear to have been collected on sandstone or shale derived soils (USACE 1990). The small, bulb-like rhizomes described under B. /ongi/lora are also found in B. kerrii. Boesenbergia collinsii Mood & L.M.Prince, sp. nov. Boesenbergiae longiflorae affinis, rhizomatium parvorum aliquot absentia radicibus longis crassis tuberosis abuntis, pseudocaule breviore 50-80 cm longo, floribus maioribus 4-4.2 cm longis 3 cm latis differt. TYPUS: Mood 12P171, Cultivated in Hawaii, USA, | Nov 2012 (holo BK; iso AAU). Originally from Thailand, Loei Province, eastern border with Nong Bua Lamphu Province, along road to Udon Thani, no exact location, c. 300 m asl, August 2003, Collins T-306$, cultivated as MO6P14. (Fig. 10, 11, 17 & 19C) Deciduous herb up to 80 cm tall; rhizome small, elongate c. 5 x 0.5 cm, externally brownish, internally yellow; tuberous roots prolific, c. 15-20, c. 10 x 1 cm, swelling to 1.5 cm in the lower third or tapering, externally pink, internally three concentric pink rings, root hairs many, c. 8 mm long, thin, white. Pseudostem up to c. 20 cm long, composed of leaf sheaths, base oval, c. 2-2.5 cm diam., 1-2 leafless sheaths at the base, leaf sheaths longitudinally ridged, green or green and red, glabrous, margin hyaline. Leaves 5-6 per pseudostem; petiole 12-16 cm, deeply channelled, light green or reddish, glabrous; ligule slightly bilobed, lobes an extension of the hyaline margin, c. 3 mm long, white, glabrous; lamina elliptical or broadly ovate, c. 28-44 x 12-19 cm, ventrally dark green, glabrous, dorsally lighter green, glabrous with a few hairs on the midrib, base rounded to cordate, sometimes asymmetric, apex acute to long acuminate. Inflorescence radical, c. 3-6 or more per pseudostem, up to c. 9 cm long (including peduncle) produced from the rhizome below the stem; peduncle c. | cm long, white, glabrous, basal sheaths 1-2, white, glabrous; spike horn-shaped, 5-8.5 x 3 cm. Bracts cymbiform, c. 4, c. 5-8 x 1.5-2 cm, distichously arranged, green or dark red, each bract enclosing one flower, apex sometimes curved; bracteole cylindrical, c. 5 x 0.5 cm, white, translucent, glabrous, open to the base, apex acute. Flowers c. 4 per inflorescence, up to c. 15 cm long. Calyx tubular, 2 x 0.5 cm, white, translucent, Boesenbergia longiflora and related taxa 69 Fig. 10. Boesenbergia collinsii Mood & L.M.Prince. Ink line drawing with watercolour of the type plant by Linda Ann Vorobik (2012). 70 Gard. Bull. Singapore 65(1) 2013 Fig. 11. Boesenbergia collinsii Mood & L.M.Prince. A. First-day flower of MO6P/4. B. & C. Flower and plants of M3035. D. Rhizome and tuberous roots of M06P/4. (Photos: J]. Mood) Boesenbergia longiflora and related taxa 71 glabrous, apex bi-dentate. Floral tube 14 cm long, 3 mm wide at the base, white, glabrous externally and internally, dorsal corolla lobe lanceolate, 3-3.2 x 1 cm, creamy white, glabrous, margins involute, ventral lobes linear, 4 x 0.6 cm, creamy white, glabrous, margins involute; androecial tube cup-shaped, c. 8 mm long, c. 5 mm diam. at the top, yellow, glabrous externally and internally. Labe/lum saccate, semi-orbicular, 4-4.2 cm long, 3 cm wide (when flattened at broadest point) light yellow, throat centre bright orange-red, maculate with yellow showing through as dots, interrupted with a yellow, irregular band, then a dark red band across the lip, turning to pink towards the apex, externally with a few glandular hairs, internally glabrous, margin entire, revolute on the sides, apex slightly truncate, wavy; lateral staminodes obovate, 1.6 * 1 cm, light yellow, dorsal surface with few glandular hairs, ventral surface glabrous, apex rounded, revolute, margin wavy. Stamen || mm long, filament 1.5-2 mm long, 2-3 mm wide at the base, light yellow, few glandular hairs, anther c. 9 mm long, 3 mm wide (first day) then c. 6 mm wide (thecae diverging on the second day) apex slightly bilobed with no anther crest, thecae 9 x 1 mm, red, dehiscing along the entire length. Ovary c. 8 x 5 mm, trilocular, axile placentation, white, glabrous; szyle filiform, white, glabrous, sfizma rounded to oval, white, ostiole oval, without cilia, exuding a sticky liquid on the second day; epizynous glands narrowly ovate, two, 5 mm long, light yellow. Fruiz a capsule, elliptical, c. 2 cm long, | cm wide, trilocular, white, glabrous, dehiscence loculicidal, valves rolling outward into coils; seed round, c. 15, c. 3 mm diam., light brown, slightly pubescent, aril white, translucent. (Measurements based on living, cultivated material of M06P1/4). Distribution. This species is more northerly in distribution than B. kerrii, extending from Northern Lampang Province into Southern Lamphun Province. Moving eastward, the species is not documented again until the mountains of northern Phitsanulok Province, then northward into Loei and Nong Bua Lamphu Provinces. Currently, there are no known specimens from the Lao P.D.R. Ecology. This species has been found only on or around the base and slopes of limestone outcrops in secondary forest with bamboo. Specimens from eastern Thailand also occur on the lower slopes of larger mountains with limestone geology. The plants prefer wet, but well-drained micro-habitats, even growing in the cracks and crevices of rock similar to B. kerrii. A single plant was found growing in a tree crotch, possibly indicating some consumption of the capsules and seed by rodents or birds. Plants can occur singly or as small populations of scattered individuals. Phenology. Flowering from June to mid-October with a two-day flowering cyele for each flower. Etymology. Named for Mark Collins (1963-2011) an American horticulturist who was an avid plant collector and enthusiast. For over twenty years he promoted Zingiberales worldwide and provided hundreds of plants to botanical gardens for conservation. This 72 Gard. Bull. Singapore 65(1) 2013 new species was one of the numerous collections Collins brought to the attention of the first author over many years of cooperation. Additional specimens examined: THAILAND. Lamphun Province. Li District, 4 Sep 2010, Mood & Triboun 2010 (BISH; *); Li District, 5 Sep 2010, Mood & Triboun 2011 (BISH; *). Lampang Province. Wang Tong District, 12 Aug 1998, Mood & Pedersen 1455 (C; *);, Wang Nua, 28 Jun 1996, Maxwell 96-927 (BKEF, CMU, L). Phitsanulok Province. Tung Salaeng Luang, Jul 1966, Larsen 832 (AAU, BKF; *). Phetchabun Province. Pa Prack, Nam Naw, 19 Jun 1964, Chantanamuck 789 (BKF). Loei Province. Phu Luang, 18 Sep 1963, Phusomsaeng & Bunchuai 47 (BKF);, Loei, Triboun 1424 (BKF; *). Nong Bua Lam Phu Province. Suwannakuha District, Ban Chokchai, 16 Aug 2011, Mood & MeMakin 3035 (BISH; *). Chaiyaphum Province. Thung Lui Lai, 27 Jul 1999, Newman 934 (BKF, E; *). Khon Kaen Province. Pha Nok, Khao, 9 Sep 1963, Smitinand 1123 (AAU; *). Notes. Boesenbergia collinsii is similar to B. kerrii, but the former has a smaller stature with broader lamina that tend to become horizontal when mature. The flower of B. collinsii 15 also larger and longer with more varied coloration and pattern. The plant normally lacks the many bulb-lke rhizomes at the base of the pseudostem found in B. kerrii and B. longiflora. Boesenbergia maxwellii Mood, L.M.Prince & Triboun, sp. nov. Boesenbergiae longiflorae (Wall.) Kuntze affinis, floribus maioribus 4.5 cm longis 2.7-3.0 cm latis, labello elongato minus saccato albo demum lutescenti maculis rubris roseis vel violaceis differi. TY PUS: Mood & Triboun 12P172, Cultivated in Hawaii, USA, 1 Nov 2012 (holo BK; 1so AAU). Originally from Thailand, Tak Province, Mae Lamung, secondary forest, granitic soil, c. 750 m asl, 15*48.085'N 98*53.754'E, 9 July 2010, Mood & Triboun 2032, cultivated as M2032. (Fig. 12, 13, 18 & 19D) Deciduous herb up to 1.5 m tall; rhizome small, globular to elongated, c. 1-2 cm diam., externally yellow, internally light violet, numerous cylindrical, tuberous roots extending from the rhizome base, c. 10-20x 0.5-0.8 cm, tapering, then enlarging into a tuber, c. 2 * 3 cm, externally white, internally pink, translucent, root hairs c. 18 mm long, thin, white. Pseudostem up to c. 30 cm, composed of leaf sheaths, base oval, c. 2-3 cm diam. several leafless sheaths at the base, sheaths longitudinally ridged, externally green, glabrous, internally yellow (core) margin hyaline. Leaves 4-6 per pseudostem; petiole c. 5-30 cm, channelled, light green, glabrous; ligule slightly bilobed, c. 2 mm long, lobes an extension of the hyaline margin, acute, green, glabrous; lamina elliptic, c. 33-50 x 15-25 cm, ventrally dark green, glabrous, dorsally lighter green, glabrous with a few hairs on the midrib, base rounded to cordate, apex acute. Inflorescence radical, c. 3—10 per pseudostem, up to 15 cm long (including peduncle) produced from the rhizome below the stem, pedunele 3-5 x 0.5-8 cm, white, glabrous, basal sheaths 1-2, white or pink, glabrous; spike horn-shaped, c. 8-10 x 2 cm. Braczs cymbiform, 5-7, c. 5-8.5 x 2-3 cm, distichously arranged, white and pink or red, translucent, Boesenbergia longiflora and related taxa 73 Fig. 12. Boesenbergia maxwellii Mood, L.M.Prince & Triboun. Ink line drawing with watercolour of the type plant by Linda Ann Vorobik (2012). 74 Gard. Bull. Singapore 65(1) 2013 Fig. 13. Boesenbergia maxwellii Mood, L.M.Prince & Triboun. A. First-day flower of M2032. B. Flowers of M2032. C. Flowers of MIIP124. D. Flower of M//P26 from the Lao P.D.R. E. Flowers, Chin State, Burma. F. Rhizome and tuberous roots of M/2040. (Photos: A-D & F.J. Mood; E, H. Funakoshi) Boesenbergia longiflora and related taxa 75 glabrous, each bract enclosing one flower, apex attenuate; bracteole cymbiform, c. 4 x 0.5 cm, white, translucent, glabrous, open to the base, apex 2-dentate. Flowers 5-7 per inflorescence, up to c. 16 cm long. Calyx tubular, 3 * 0.5 cm, white, translucent, glabrous, apex tri-dentate. Floral tube c. 12-14 cm long, 3 mm wide at the base, white with a pink tinge, glabrous externally and internally, dorsal corolla lobe oblong, 3.6 * 1.3 cm, white, glabrous. apex cucullate, margins involute, ventral lobes linear, c. 4.3 x 1 cm, white, glabrous, apex sometimes cucullate, margins involute; androecial tube cup-shaped, c. 10-16 mm long, c. 12 mm diam. at the top, white, glabrous externally and internally. Labellum slightly saccate. elongate, 4.5-5.0 cm long, 2.7—3.0 cm wide (when fiattened at the broadest point) white, throat centre orange-red, maculate with white showing through as dots, lip with an irregular, dark pink band, followed with a lighter pink and white band to the apex, abaxial surface with few glandular hairs, lip surface crinkled, margins crisped, apex entire, irregular; lateral staminodes obovate, c. 2.3 x | cm, white, abaxial surface with few glandular hairs, margins irregular, apex revolute. Sfamen 12 mm long, filament c. 3 mm long, c. 2 mm wide at base, white, few glandular hairs, anther 10 mm long. 3 mm wide (first day) then c. 6 mm wide (thecae diverging on the second day) apex slightly bilobed, with no anther crest, thecae 10 x 1 mm, white, dehiscing along the entire length. Ovary c. 7 * 3 mm, trilocular, axile placentation, white, glabrous; szyle filiform. white, glabrous, sfizma round, white, ostiole round, without cilia, exuding a sticky liquid on the second day; epigynous glands linear, two, 6 mm long, tan. Fruit a capsule, cylindrical, slightly ridged, c. 2 x 1 cm, trilocular, white, glabrous, calyx and floral tube remain partially intact, dehiscence loculicidal; seed globular, c. 3 mm diam., yellowish-brown, slightly pubescent, anil white, translucent. (Measurements based on living, cultivated material of M2032). Distribution. This species is very common in northern Thailand. Collections from Chin State, Burma and the Lao P.D.R. are known. It might also occur in Yunnan, China. Ecology. This species occurs in a variety of forest types to include evergreen, dry deciduous and mixed evergreen/deciduous. Most collections are at middle to higher elevations in mountainous terrain. Soil types vary from granitic to calcareous with high organic matter content. Phenology. Flowers from June to November with a two-day flowering cycle for each flower. Etymology. Named in honour of James F. Maxwell, Curator of the Chiang Mai University Herbarium, Thailand (CMU). For many years he has diligently collected, documented, identified and preserved the flora of Thailand, Burma, Cambodia and the Lao P.D.R. to include hundreds of Zingiberaceae. Several of his collections represent this new taxon. Additional specimens examined: BURMA. Chin State. Kanpetlet, Laung Pan, Aug 2011, Funakoshi s.n. (MBK: *); Kanpetlet, near Laung Pan. Aug 2011. Funakoshi s.n. (MBK). 76 Gard. Bull. Singapore 65(1) 2013 LAO P.D.R. Champasak Province. Near Pakxong, secondary forest, 2006, 1286 m., collected by T. Wood, Mood 11P26 (BISH; *). THAILAND. Mae Hong Son Province. 6 Sep 2010, Mood & Triboun 2017 (BISH; *), Mae Hong Son, Khun Yuam, 5 Sep 1974, Larsen 34174 (AAU). Chiang Mai Province. Dong Duat waterfalls, 4 Sep 1999, Mood 11P124 (BISH; *); Chiang Mai, Fang, 7 Jun 1973, Geesink 5750 (BKF);, Chiang Mai, Doi Sutep, 18 Jun 1988, Maxwell 588-875 (BKF; *); Chiang Mai, Sop Aep, 1 Oct 1971, Murata 7-15458 (BKF); Chiang Mai, Mae Sanam, 27 Jun 1978, Phengkhlai 4140 (BKF);, Chiang Mai, Doi Inthanon 14 Jul 1990, Phengkhlai 7516 (BKEF); Chiang Mai, Doi Inthanon NP, 20 Jul 1988, Phengkhlai 6619 (BKF; *); Chiang Mai, Doi Chiang Dao, 25 Sep 1971, Murata T-14944 (AAU, BKF; *); Chiang Mai, Doi Inthanon, 20 Jul 1988, Zamura 7-60130 (BKF);, Chiang Mai, Doi Sutep, 9 Aug 1988, Tamura T-60782 (BKF); Chiang Mai, Doi Chiang Dao, 9 Jun 1955, Fehrain 12477 (BKF); Chiang Mai, Doi Sutep, 11 Jul 1987, Maxwell 687-659 (BKF, CMU, L; *); Chiang Mai, Chiang Dao, Doi Chiang Dao, 10 Jun 1989, Maxwell 859-731 (E); Chiang Mai, Fang, 26 May 1991, Maxwell 91-509 (E); Chiang Mai, Bo Luang, 4 Jul 1968, Larsen 2097 (AAU, BKF, L); Chiang Mai, Doi Inthanon, 15 Sep 1995, Larsen 46499 (AAU); Chiang Mai, Doi Chiang Dao, 11 Sep 1967, Tagawa T-9865 (AAU); Chiang Mai, Baan Tham, Doi Chiang Dao, Warrhana 737 (AAU). Lampang Province. Lampang, Doi Kuhn Dahn, 27 Jun 1993, Maxwell 93-695 (BKF, CMU, L; *); Lampang, Jae Sawn NP, 24 Aug 1995, Maxwell 95-575 (BKF, CMU, L). Tak Province. 9 Aug 2010, Mood & Triboun 2040 (BISH; *). Chiang Rai Province. Chiang Rai, Doi Yup, 13 Jun 1926, Garrett 294 (BKF); Tha Sai, 12 Aug 1998, Mood & Pedersen 1450 (62): Notes. This species is closely related to B. kingii as discussed in the phylogenetic analyses. Since B. maxwellii has a rhizome architecture different from B. kingii, there is little chance of misidentification where their ranges might overlap, i.e., Burma, Thailand and possibly China. The most westerly (known) record of B. maxwellii is in Chin State, Burma, separating it geographically from B. hamiltonii. Boesenbergia maxwellii difters from the latter in having larger flowers, different flower shape, greater labellum texture, orange throat, a light and dark pink labellum and plant size îg.c. 1.5. Boesenbergia kingii Mood & L.M.Prince, sp. nov. Boesenbergiae longiflorae (Wall.) Kuntze afinis, caulibus multiplicis, floribus maioribus 5-6 cm longis 2.5-2.7 cm latis, labello minus saccato elongato cremee albo fauce rubra differt. TYPUS: Mood & Vatrcharakorn 12P173, Cultivated in Hawaii, USA, | Nov 2012 (holo BK; iso AAU). Originally from Thailand, Kanchanaburi Province, Huai Kayeng, secondary forest margin, c. 200 m asl, 14*38.49'N 98*31.40'E, 21 August 2011, Mood & Vatcharakorn 3074, cultivated as M3074. (Fig. 14, 15, 18 & 19E) Deciduous herb up to c. | m tall; rhizomes numerous, horizontal runners of variable length, multiple nodes, c. 0.5-1.5 cm diam., pink or red when young, orange or red when mature, internally yellow to orange; tuberous roots few, elongate c. 6 x 0.3 cm, orange or white externally and internally, root hairs few, short, thin, white. Pseudostems many, up to 30 cm, composed of leaf sheaths, base oval, c. 2.5 cm diam., 1-2 short, Boesenbergia longiflora and related taxa 7 — —— <, i ad Fig. 14. Boesenbergia kingii Mood & L.M.Prince. Watercolour on paper by Edward King of G. King 1020 (1874). Originally annotated as Gastrochilus longiflora. Reproduced by kind permission of the Director, Botanical Survey of India. 78 Gard. Bull. Singapore 65(1) 2013 Fig. 15. Boesenbergia kingii Mood & L.M.Prince. A. Flower of M3074. B. Flower of MO8P161. C. Plant habit of M3074. D. Inflorescence, flower and leaf of M3074. E. Rhizomes of M3074. F. Spreading habit (Assam, India). (Photos: J. Mood) Boesenbergia longiflora and related taxa 79 leafless sheaths at the base, leaf sheaths longitudinally ridged, cross-hatched, reddish or green, glabrous, margin hyaline. Leaves 3-7 per pseudostem; petiole 11-15 cm, deeply channelled, green or red, glabrous; ligule slightly bilobed, an extension of the hyaline margin, 4 mm long, white, translucent, glabrous; lamina elliptical 40-45 x 15-16 cm, ventrally dark green, glabrous, dorsally lghter green, glabrous with a few hairs on the midrib, base rounded to cordate, apex acute to attenuate. Inflorescence radical, c. 3-10 per pseudostem, up 18 cm long (including peduncle) produced from the top of the horizontal rhizome near the pseudostem, peduncle 1-3 x 0.5-1 cm, white or pink, glabrous, basal sheaths 1-2, 4-6 x 1.5-2 cm, white; spike cylindrical, slightly asymmetric, 11-14 x 1-1.5 cm. Braczs linear to cymbiform, 4-5, c. 6-11 x 1.5-2 cm, distichously arranged, white, green or red, glabrous, surface veined, each bract enclosing one flower, apex acute; bracteole lanceolate, c. 5-6 x 0.5 cm, white, translucent, glabrous, open to the base, apex 2-dentate. Flowers 4-5 per inflorescence, up to c. 20 cm long. Calyx tubular, 2-2.3 x 0.5 cm, white, translucent, glabrous, apex tri-dentate. Floral tube c. 10-15 cm long, c. 0.3—0.4 cm wide at the base, white, tinged or striped pink, glabrous externally and internally, corolla lobes (dorsal and ventral) oblong, c. 3.8-4 * 1.4 cm, creamy-white, glabrous, margins involute; androecial tube cup-shaped, c. 10-12 mm long, c. 13 mm diam. at the top, white, glabrous externally and internally. Labellum slhghtly saccate, elongate, 5-6 cm long, c. 4 cm wide (when flattened at the broadest point) white to creamy-white, throat centre bright red, maculate with white showing through as dots, lip creamy-white, abaxial surface with a few glandular hairs, margin undulate, wrinkled, apex entire; Jateral staminodes obovate, 2.5 x 1.5 cm, creamy-white, abaxial surface with few glandular hairs, apex rounded, revolute. Sramen 12 mm long, filament 3-4 mm long. 2-3 mm wide at the base, white, glabrous, anther 8-9 mm long, 3 mm wide (first day) then c. 5 mm wide (thecae diverging on the second day) apex slightly bilobed with no anther crest, thecae 9 x 1 mm, white, dehiscing along the entire length. Ovary c. 7 * 3 mm, trilocular, axile placentation, white, glabrous; style filitorm, white, glabrous, stigma elongate, white, ostiole vertically rectangular, without cilia, exuding a sticky liquid on the second day; epigynous glands narrowly ovate, two, 8 mm long, white. Fruit not seen. (Measurements based on living, cultivated material of M3074). Distribution. A widespread species, found in Bangladesh, Burma, NE India, SW China and Thailand. Ecology. The type locality is in a disturbed area on the margin of a secondary, riverine forest in very light shade at c. 200 m asl. The soil is a brown, gravelly alluvium. Recent observations of this species in Eastern Assam and Eastern Thailand were in disturbed, lowland forest with light shade. From limited observations, it seems to prefer flat terrain with loose soils having high moisture holding capacity. Phenology. Flowers from May to September with a two-day flowering cycle for each flower. 80 Gard. Bull. Singapore 65(1) 2013 Etymology. Named in honour of Sir George King (1840-1909) a Scottish medical doctor and botanist who worked in India starting in 1865 after graduation from medical school. For a short time he was Superintendent of the Garden at Saharanpur and Conservator of Forests in that area. From 1870-1897, he was the Superintendent of Calcutta Botanic Gardens. During the same period he became the first Director, Botanical Survey of India (Burkill 1965). His contributions to botany and science are numerous and far-reaching. The specimen King 1020 (CAL) is the first known collection of this new species. Additional specimens examined. BANGLADESH. Chittagong Division. Kaptai Lake, 5 Sep 1999, Newman 980 (E; *); Chimbuk Hill, Bandarban Hill Tracts, 8 Sep 2000, Newman 990 (E; *). BURMA. Sagaing Division. Katha Dist., Pile R.F., 20 Aug 1915, Rogers 997 (CAL; *); Alaungdaw Kathapa National Park, 17 Jul 1997, Kress 97-5821 (US; *). Mandalay Division. Maymyo Hills, Jun 1888, Khan 50 (CAL; *); Mt. Popa Park,17 May 1996, Kress 96-5646 (US; *). Shan State. 45 miles east of Pyin-Oo-Lwin, 26 Jun 2003, Kress 03-7366 (US; *). CHINA. Yunnan Province. Xishuangbanna Prefecture (cultivated at Xishuangbanna B.G.) 1 Jul 2009, Mood 2002 (BISH; *); Culyun Village, 49 km SW of Simao, 12 Jul 2009, Kress 09-8664 (US; *). INDIA. Sikkim. Teesta Valley, 22 Jul 1874, King 1020 (CAL; *);, Assam. Nambar Forest, 8 May, 1895, Reporter 11375 (ASSAM; *). THAILAND. Phetchabun Province. Nam Nao vicinity, 14 May 2012, Mood & Varcharakorn 3272 (BISH; *). Notes. The type selected here with a creamy white flower, dark red throat and white apex is the most common form observed across the range and as depicted in King's illustration (Fig. 14). Another form has also been observed with dark pink to light violet colouring on the apex similar to the colours of B. hamiltonii. Based on limited observations, this latter form seems to be less robust with shorter pseudostems and smaller diameter rhizomes. The multi-stemmed habit of B. kingii (în both forms) is the result of the rhizome morphology—running in habit with multiple growth nodes similar to a stolon (Fig. 15F). These runners grow outward from the initial plant in various directions, often producing a new pseudostem at a major node. The result can be a large, clonal population such as at the type locality, where it encompasses over 30 m? with hundreds of interconnected stems (Fig. 15C). In ex situ experiments a planted piece of broken rhizome produced a new mass of running rhizomes with several pseudostems after one year of growth. In this vein, a specimen from Burma, C.G. Rogers 991 (CAL) is annotated, “Prevents the natural regeneration of Teak.” This statement can now be understood with more clarity—B. kingii has the potential for rapidly spreading once established in a suitable area. Boesenbergia hamiltonii Mood, S.Dey & L.M.Prince, sp. nov. Boesenbergiae longiflorae (Wall.) Kuntze affinis, floribus maioribus 3.5-4.5 cm longis 2.3-2.8 cm latis, labello elongato minus saccato albissimo signis rubris roseis violaceisque differt. TYPUS: Dey NUS3, India, Meghalaya, Riboha District, Nongpoh, tropical, semi- evergreen forest, steep hillside along highway, c. 350 m asl, 25*57.5'N 91*51.183'E, July 2009 (holo CAL; iso ASSAM). (Fig. 2, 16, 18 & 19F) Boesenbergia longiflora and related taxa Sl Gastrochilus jenkinsii Wall. ex Voigt, Hort. Suburb. Calcutt.: 572 (1845), nom. inval., sine descr. — Voucher: Jenkins s.n. (CAL) India, Assam, Gowahatti. Bangleum sulphureum Ham., nom. nud. = Alpinia hamiltoniana Wall., Numer. List: 4% 6579. 1832, nom. nud. — Voucher: Hamilton Ao 1808 = Wallich 6579A, India, Gualpura, 30 May 1808 (K-W). Gastrochilus longiflorus auct. non Wall.: Hooker in Curtis's Bot. Mag. 69: t. 4010 (1843) (hand-coloured plate by W. Fitch; “Long-flowered Gastrochilus”); in Hook.f., FI. Brit. India 6: 217 (1890) (= G. jenkinsii). — Voucher: Hooker in Curtis's Bot. Mag. 69: t. 4010 (1843). Curcumorpha longiflora auct. non A.S.Rao & D.M.Verma: A.S.Rao & D.M.Verma, Bull. Bot. Surv. India 13: 339 (1974) (“1971”) pro specim. Deciduous herb up to | m tall; rhizome to c. 2.3 cm diam. externally yellow-brown, internally yellow; many cylindrical, tuberous roots extending from the rhizome base, c. 12 x 0.5 cm, externally pink, internally white, sometimes with a swollen apex. c. 1 cm diam., 2 cm long; fibrous roots c. 45-50 x 0.1 cm, yellow-white, with many secondary root hairs. Pseudostem up to c. 30 cm long, composed of leaf sheaths, base round to oval, c. 2.5 cm. diam., several leafless sheaths at the base, green, glabrous, leaf sheaths 12-24 cm, longitudinally ridged, lower portion reddish, upper green, glabrous. Leaves 3-6 per pseudostem; petiole 8-26 cm, deeply channelled, lhght green, glabrous; ligule, slightly bilobed, lobes an extension of the hyaline margin, 2 mm long, green or white, glabrous; lamina elliptical, 34-44 x 15-19 cm, plicate, ventrally dark green, glabrous, dorsally lighter green, glabrous with a few hairs on the midrib, base rounded to cordate, apex acute. Inflorescence radical, c. 3-10 per pseudostem, up to c. 19 cm long (including peduncle) produced from the rhizome below the pseudostem, pedunele 5-9 x 0.8 cm, white, glabrous, basal sheaths 1-2, 3.5— 4.5 x 1-1.5 cm, white, glabrous; spike horn-shaped, 8-11 x 2 cm. Braczs cymbiform, 4-6, to c. 9 cm, distichously arranged, green and white, sometimes red, each bract enclosing one flower, apex sometimes curved; bracteole cymbitorm c. 5-6 * 0.4 cm, white, translucent, glabrous, open to the base, apex 2-dentate. Flowers 4-6 per inflorescence, up to c. 15 cm long. Calyx tubular, 2-2.4 x 0.5 cm, white, translucent, glabrous, apex tri-dentate. Floral tube c. 9-12 cm long, 3-4 mm wide at the base, white tinged with pink, glabrous externally and internally, corolla lobes (dorsal and ventral) oblong, c. 4 x 1.2 cm, white, glabrous, margins involute; androecial tube cup- shaped, c. 8-10 mm long, c. 12 mm diam. at the top, white, glabrous externally and internally. Labellum slightly saccate, elongate, 5-5.5 cm long, 3.5-4 cm wide (when flattened at the widest point) lip margins slightly crisped, crinkled, apex emarginate, white, throat centre red, maculate with white showing thru as dots, colour broadening toward the margins, ending c. 12 mm from apex, lip entirely pink to the apex, abaxial surface with few glandular hairs; lateral staminodes obovate, 1.8 * 1.5 cm, white, abaxial surface with few glandular hairs, apex rounded to slightly acute, margins revolute in part. Stamen 12-14 mm long, filament 3 mm long, 3 mm wide at the base, white, glabrous, anther 10-12 mm long, 3 mm wide (first day) then c. 8 mm wide 82 Gard. Bull. Singapore 65(1) 2013 Fig. 16. Boesenbergia hamiltonii Mood, S.Dey & L.M.Prince. A. First-day flower. B. First-day flower. C. Mature plant. D. Rhizome and tuberous roots. All photos of Dey NU53. (Photos: J. Mood) Boesenbergia longiflora and related taxa 83 (thecae diverging on the second day) apex truncate to slightly bilobed with no anther crest, thecae 10-12 x 1 mm, white, dehiscing along the entire length. Ovary c. 5 * 4 mm, trilocular, axile placentation, white, glabrous; szyle filiform, white, glabrous, stioma €longate, ostiole vertically rectangular, without cilia, exuding a sticky liquid on the second day; epigynous glands narrowly ovate, two, 5 mm long, tan-white. Fruit a capsule, cylindrical, asymmetrical, 2 cm long, | cm wide, calyx and floral tube remain partially intact, white, glabrous, surface smooth; seed globular, slightly flattened, apex rounded, tan-yellow, aril sparse, white, translucent. (Measurements based on living, wild material at the type location in India of Dey NU53). Distribution. This taxon has been recorded primarily in Meghalaya and hill areas of Assam. Its full range has not been determined. Ecology. This species is normally found in sloped habitats where there is some shade, good soil moisture and excellent drainage. Most plants are seen along roadside banks on forest margins or more rarely in open forests. Observed elevations range up to 500 m asl, although Rao & Verma (1974) reported elevations up to 1850 m asl. The type specimen was found growing under light shade in deep, black, well drained soil on the margin of a disturbed secondary forest at 350 m asl. Associated plants were Shorea robusta C.F.Gaertn., Tectona grandis L.f., Musa species, bamboo and understory herbs. Phenology. Flowers from May to September with a two-day flowering cycle for each flower. Etymology. Named for Francis Buchanan Hamilton (1762-1829) a Scottish surgeon and botanist in the employ of the East India Company from 1794-1815. His botanical research, collections, geographic documentation and statistical surveys provided a solid foundation for future explorers and botanists in Northeast India, Burma and Nepal. He served as Superintendent, Calcutta Botanical Gardens between 1814-1815. His two specimens of Bangleum sulphureum from 1808 appear to be the first collections of this new taxon. Additional specimens examined: BANGLADESH: Sylhet Division. Laour, Jun 1830, Gomez in Wallich 65798 (K-W; *). INDIA. Assam. Camrupa, 21 Jul 1808, Hamilton 12 (E; *); Goalpara, Hamilton s.n. (Wallich 65794, K-W, CAL); no location, no date Jenkins s.n. (ASSAM); Kamrup Dist., 13 Jun 1964, Rao 38791 (ASSAM; *); Darrang, Batasipur, 12 May 1947, Srinivasan 22411 (ASSAM);Tangla, 24 May 1958, Nath 13387 (ASSAM); Sibsagar, Panbari, 15 Jun 1963, Deb 34846 (ASSAM). Meghalaya. Nongpoh, 31 Jun 1964, Joseph 37477 (ASSAM; *); Nowgong Dist., 18 Aug 1964, Ba/akrishnan 39222 (ASSAM); Nowgong Dist., 31 Aug 1938, De 20327 (ASSAM); Nowgong Dist., 25 Aug 1964, Balakrishnan 39415 (ASSAM); Khasia Hills, J.D. Hooker s.n. (ASSAM. C:; *); Garo Hills, 6 Sep 1962, Deb 29216 (ASSAM); Khasia & Juanita Hills, 4 Jul 1938, De 20326 (ASSAM); Khasia & Juanita Hills, 8 Jun 1939, Deka 19668 (ASSAM); Khasia & Juanita Hills, 4 Jul 1940, Deka 202364 (ASSAM); Khasia & Juanita Hills, 23 Jun 1941, De 27089 (ASSAM; *). 84 Gard. Bull. Singapore 65(1) 2013 Notes. This species is distinguished from B. kingii by the small, short rhizome with long, vertical tuberous roots which usually produces only a single, robust pseudostem (Fig. 16D). Indicative of this below-ground morphology, B. hamiltonii is easily recognized in the field by the widely scattered, individual plants, occurring in a low- density population of seeded individuals (Fig. 16C). In contrast, B. kingii occurs in multi-stemmed, high-density populations of clonal and seeded individuals (Fig. 1SC, F). Fig. I7A & B. Flowers. Left: Boesenbergia collinsii (M3035), Centre: B. kerrii (M2044); Right: B. longi/lora (M11P48). (Photos: J]. Mood) i Boesenbergia longiflora and related taxa 85 The flower colour of B. hamiltonii is pure white with a red, maculate throat and a pale pink lip apex. Colour variations between populations are primarily in degree of pigmentation. When the labellum is dissected and flattened, it is very similar in shape to B. kingii, but in living plants the full open, frontal shape is oval in the former and truncate or rounded in the latter. As a historical note, after Hamilton collected his two (Banglium) specimens in 1808, he used “su/phureum” (light yellow) as the specific Fig. 18A & B. Flowers. Left: Boesenbergia maxwellii (MI1P124); Centre: B. kingii (M11P77) Right: B. hamiltonii (M3209). (Photos: ]. Mood) 50 Gard. Bull. Singapore 65(1) 2013 epithet. Initially, this was a confusing issue, since no yellow flowered Boesenbergia had been described from NE India. Later, this anomaly was understood after examining the newly pressed flowers ofall of the specimens used in this study. No matter what the original living flower colour, all turned a light yellow after drying. It appears Hamilton based his species descriptor on the dried flower colour rather than on fresh flowers. This yellow coloration can still be seen on Hamilton 12 (E). Fig. 19. Stamens & labellum. A. Boesenbergia longiflora (MI1P48). B. B. kerrii (M2044). C. B. collinsii (M3035). D. B. maxwellii (MI1P124). E. B. kingii (MI1P77). FE. B. hamiltonii (M3209). (Photos: ]. Mood) Boesenbergia longiflora and related taxa 87 Conclusions and further research Our study fully supports Larsen's (1997) conclusion that Curcumorpha should be reduced to Boesenbergia. This is based on the phylogenetic analyses showing the B. longiflora clade nested within the larger Boesenbergia clade (Fig. 3). In further support, three of the four characters Rao & Verma (1974) used to justify Curcumorpha have been found to occur in other Boesenbergia species. Their fourth character, spiral bract arrangement, was misinterpreted and bracts are in fact distichously inserted in taxa throughout the B. /ongiflora clade. Some of their cited specimens are now determined as B. hamiltonii. Fig. 20. Geographical distribution of the Boesenbergia longiflora clade showing type localities. B. collinsii (yellow), B. hamiltonii (light blue), B. kerrii (red), B. kingii (white), B. longiflora (dark blue) and B. maxwellii (green). Each specimen mapped is noted by an asterisk following the herbarium abbreviation under the “Additional specimens examined”. (Mapped in GOOGLE earth, US Dept of State Geographer, 2013 Cnes/Spot image, 2013 Mapabc.com and 2013 Google). Gard. Bull. Singapore 65(1) 2013 88 S)001 JBoUIeIp S1001 SnoI9qn) [eOII9A UI S'1—S:0 SnoI9qn) |eOIISA S7001 Sn012qn) “3uo] :]]evus *SBUIOZIUI S1001 SNEIANI [POIIOA OU Aueuu [POIUIOA MO 89001 SN0I9qN7 [EONIOA BINPANUAIe BUIOZIVI Suruun. Aueuu 3uo] ]]evus auoziyI “Ţ[eLUS BUWOZII S[|eUUS SUIOZIYI MOŢ ÎŢ|euus 9UIozIyI punorăepu au 7-01 VIU 6-8 tuuu 0] VIU 6 VIU 6 VIU / Yăuo 19Wuv unu 0-8 wi CI-OI wu 91-01 Wu 8 ULUI S— UIUI S—f Wysuo 2qny [elo30puy UI9 CI-6 WI SI-O W9 plc UI | WI pl-cl Lo oX0)! Yyăua] 2qn] [e-0l4 US) Sp AG UO (ic Ul 0i gi 0 Si WOExTy-p WOTIxV-8£ WOCC-OTxST ICC (M x 1) tunyloqeT Ae3uo[a “ayeooes Ae3uo[e Ae3uo[2 “oyeooes Apus “oyeoodes APUSI[S Apus 2jeooes AJeo9es IOV “AJPODES AIOA adeys vunjogqe] xode 0] SUONLUIQUIOO ud pue uroed poxeos Surd twuopiun XUId XIep 10 ANM V9ŢOIA 10 Xurd “pai “POI XIEP UUM par XIep “eoay) xade 07 ULM JPOIU) Pal ULM “YeOI) pal ULM JPOIU) 9UPI0 JeOIU) pal par-o3uelo — 3uruapeo1q POI) pol 1N0[09 uloned vunjoqe] MOIJoA "31 Surose “ANIM AUIa19 MOJJRA Auueao MOJJRĂ ANUM 10 arm ond arm oand 10 XIep U51] MOŢ2A 1931] tunIpouu 1N0[09 19MOŢAI (11) 6-s -€ LS LA se €-T 99205810! 19d SI9M0ȚA MU0]IUDU nu 'g 1]J2AXbU "9 11SU1]J02 'g 11442) 'g9 D40p/18U0] 'g J9PeIey) “(un[oqe[ pue yusure[ “SopoOuruIeIs JO AXU93IBAIP JO JUl0d) xode 2qQny [EIOB01pue 0) S9q0[ 20109 30 aseq = W3uo] 2qny Ţeroaoapue 5990] 2]10109 Jo aseq 07 AreAo go xade = U3u2| 99n [EIOA "[ELIOeUUI BULAI UIOI; PBALISP 91 SusuoInstoul [|V '9pep2 D10Jfi3u0] 'd IV WI04y Sa00ds p15/0q42520g XIS JO uosIeduIo) "1 AAAeL Boesenbergia longiflora and related taxa 89 Taxa in the B. /ongiflora clade can generally be distinguished from other Boesenbergia by a combination of characters: robust plants with few leaves, radical inflorescences with distichous bracts and large, two-day flowers. Their annual life cyele begins as seed, rhizome-like bulbs (B. kerrii, B. longiflora) pieces of running rhizome (B. kingii) or mature rhizomes from the previous year. Growth begins in April or later, coinciding with the monsoon rains and continues through October when the weather becomes cooler and dry. All species are dormant for about five months. Plants of B. maxwellii grown in a difterent climate (Hawaii) with rainfall throughout the dormancy period still tollow their monsoonal cycle even after 20 years of cultivation (Mood, pers. obs.). Running rhizomes are found on all current B. kingii collections, including the putative hybrids. This character, at least in part, might account for its very wide distribution, whereas the other five species which propagate primarily through seed dispersal have a much smaller range. Specimens or pictures identified as B. longiflora in publications prior to this study should be re-determined. For instance, the plants studied by Gao et al. (2004) are not B. longiflora, but appear to represent B. kingii. Similarly, in Larsen & Larsen (2006), the Boesenbergia pictured on page 32 is B. maxwellii, while the yellow- flowered taxon on page 48 appears to be B. co/linsii. Long-term observation of cultivated gingers combined with field visits to document ecology, geology, distribution, pollination biology and other elements has shown to be an excellent strategy for the study of Boesenbergia. The daily observation of multiple collections of various taxa from initial growth to dormancy provided insight well beyond that of field observations alone. The current study represents a small segment of an on-going research project whose goal is to improve the overall knowledge of Boesenbergia by re-examining nomenclature, improving descriptions, analysing genetic relationships and providing phytochemical profiles. Additionally, further investigation of the B. longiflora clade continues to include karyotyping, phenology, biogeography and conservation status. ACKNOWLEDGEMENTS. We would like to thank W. John Kress, Mike Bordelon, Lopez, Ingrid Pol-Yin Lin (US), Mark Newman (E) for assisting with specimens, plant photography and collection data. Latin text was translated by Philip H. Oswald (Cambridge, U.K.). We thank Henry Noltie and Helen Yeats (E), Malcolm Beasley (BM), Penny Brook (British Library, UK), Gina Douglas (LINN), Louise B. Johansen (Denmark), Gitte Petersen (C), Finn Borchsenius and Olof Ryding (AAU), Nicholas Hind, Marcelo Sellaro, Lynn Parker, Tim Utteridge, Martin Xanthos, Katherine Challis (K) and Axel Poulsen (Oslo BG, Norway) for helpful discussion and assistance in preparatory research. Special thanks to Jana Leong- Skornitkovâ (SING), Peter Boyce (USM, Malaysia), Pieter Pelser (UC, NZ) David Gang (WSU, USA), Ida Theilade (UC, Denmark) and Bob Faden (US) for manuscript assistance. Special acknowledgement to colleagues in Thailand: Poonsak Vatcharakorn, Pramote Triboun (BK) Yingyong Paisooksantivatana (KU), Piya Charlermglin (TISTR) and the staff at BK and BKF. In India, special thanks to Shri Jairam Ramesh, Minister of Rural Development; Jatrinda Sarma, Assam Forestry Dept.; Paramjit Singh, Director of Botanical Survey of India, 90 Gard. Bull. Singapore 65(1) 2013 P. Lakshminarasimhan, B.K. Singh, R. Kumar; and Moaakum (Kohima Science College). The second author also thanks Rancho Santa Ana Botanic Garden for generously providing several years of financial support and The Field Museum of Natural History for current and on-going access to collections and facilities. Permissions for reprinting Figs. | and 2 were kindly granted by the Board of Trustees of the Royal Botanic Gardens Kew; for Fig. 14, by the Director, Botanical Survey of India, Kolkata, India. The original watercolours of B. co/linsii, B. kerrii and B. maxwellii were accomplished in a historical style by Linda Ann Vorobik (UCB, USA). Colour plates were created by Tiffany D. Shafto (Hawaii, USA). References Ainouche, M.L., Baumel, A., Salmon, A. & Yannic, G. (2004) Hybridisation, polyploidy and speciation in Spartina (Poaceae). New Phytol. 161: 165-172. Akaike, H. (1974) A new look at the statistical model identification. IEEE 7. Automat. Cont 19: 716-723. Alvarez, |. & Wendel, J.F. (2003) ITS sequences and plant phylogenetic inference. Molec. Phylogenet. Evol. 29: 417-434. Baker, J.G. (1890) Scitamineae. In: J.D. Hooker (ed.), Zhe Flora of British India. Vol. 6. Pp. 217-218. London: Reeve & Co. Beilstein, M.A., Al-Shehbaz, I.A., Mathews, S. & Kellogg, E.A. (2008) Brassicaceae phylogeny inferred from phytochrome A and ndh/' sequence data: tribes and trichomes revisited. Amer J. Bot. 95: 1307-1327. Burkill, I.H. (1965) Chaptrers on the History of Botany in India. Pp. 168-173. Calcutta: Bombay Natural History Society & Botanical Survey India. Cunningham, C.W. (1997) Can three incongruence tests predict when data should be combined? Molec. Biol. Evol. 14: 733-740. Don, D. (1825) Prodromus Florae Nepalensis. P. 32. London: Gale. Fan, L.N. (2004) Phylogenetic Relationship Based on Flavonoids and ITS Regions Studies on Selected Boesenbergia Species in Sabah. Unpublished thesis, University Malaysia Sabah, Kota Kinabalu, Sabah. Farris, J.S., Kallersjo, M., Kluge, A.G. & Bult, C. (1995) Testing significance of incongruence. Cladistics 10: 315-319. Fazekas, A.]., Steeves, R. & Newmaster, S.G. (2010) Improving sequencing quality from PCR products containing long mononucleotide repeats. Bio Techniques 48: 277-285. Feliner, G.N., Aguilar, J.F. & Rosell6, J.A. (2001) Can extensive reticulation and concerted evolution result in a cladistically structured data set? C/adistics 17: 301-312. Fitch, W.M. (1971) Toward defining the course of evolution: Minimum change for a specific tree topology. Ss. Zool. 20: 406-416. Fuertes Aguilar, ]., Rossell6, J.A. & Feliner, G.N. (1999) Nuclear ribosomal DNA (nrDNA) concerted evolution in natural and artificial hybrids of Armeria (Plumbaginaceae) Molec. Ecol. 8: 1341-1346. Gao, ].Y., Zhang, L., Deng, X.B., Ren, P.Y., Kong, J].]. & Li, Q.J]. (2004) The floral biology of Curcumorpha longiflora (Zingiberaceae): A ginger with two-day flowers. Amer J. Bor. 91: 289-293. Gao, J.Y., Xia, Y.M., Huang, ].Y. & Li, Q.J. (2005) An Introduction to Chinese Ginger Plants. Beijing: Science Press. Boesenbergia longiflora and related taxa 9] GenBank NIH genetic sequence database (2011) Nucleic Acids Research, 2011 Jan; 39 (Database issue): D32-7. http://www.ncbi.nlm.nih.gov/genbank/ (accessed 26 Nov. 2012). Guindon, S. & Gascuel, O. (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Sysz. Bio. 52: 696-704. Holttum, R.E. (1950) The Zingiberaceae of the Malay Peninsula. Gard. Bull. Singapore 13(1): 106-117. Hooker, W.J. (1842) Gasrrochilus pulcherrima. Handsome-flowered Gastrochilus. Curtis 5 Bor. Mag. 68: Tab. 3930. Hooker, W.J. (1843) Gastrochilus longiflora. Long-flowered Gastrochilus. Curtis s Bot. Mag. 69: Tab. 4010. Joly, S., MeLenachan, P.A. & Lockhart, P.J. (2009) A statistical approach for distinguishing hybridisation and incomplete lineage sorting. Amer. Naturalist 174: E54-E70. Kress, W.J., Prince, L.M. & Williams, K.J. (2002) The phylogeny and a new classification of the gingers (Zingiberaceae): Evidence from molecular data. Amer: J. Bor. 89: 1682-1696. Kress, W.J., Mood, J.D., Mamiyil, S., Prince, L.M., Dey, S. & Sanoj, E. (2010) Larsenianthus, a new Asian genus of gingers (Zingiberaceae) with four species. Phyrokeys 1: 15-32. Kuntze, O. (1891) Revisio Generum Plantarum 2: 685. Leipzig: Felix. Larsen, K. (1997) Further studies in the genus Boesenbergia (Zingiberaceae). Nord. J. Bor. 17: 361-366. Larsen, K. & Larsen, S. (2006) Gingers of Thailand. Chiang Mai: Queen Sirikit Botanic Garden. Leong-Skornickovă, ].. Ly, N.-S., Poulsen, A.D., Tosh, J. & Forrest, A. (2011) Newmania: A new ginger genus from central Vietnam. Taxon 60: 1386-1396. Liu, S.C., Lu, C.T. & Wang, J.C. (2009) Reticulate hybridisation of Al/pinia (Zingiberaceae) in Taiwan. J. Pl. Res. 122: 305-316. Miller, M.A., Pfeiffer, W. & Schwartz, T. (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. In: Proceedings of the Gateway Computing Environments Workshop (GCE). New Orleans, Louisiana: IEEE. Mrăz, P., Chrtek, J. & Fehrer, ]. (2011) Interspecific hybridisation in the genus Hieracium s. str.: Evidence for bidirectional gene flow and spontaneous allopolyploidisation. P/. Sysr. Evol. 293: 237-245. Ngamriabsakul, C. & Techaprasan, J. (2006) The phylogeny of Thai Boesenbergia (Zingiberaceae) based on perA-psbJ spacer (chloroplast DNA). J. Biochem. Mol. Biol. 39: 361-370. Posada, D. (2008) jModelTest: Phylogenetic model averaging. Molec. Biol. Evol. 25: 1253-— 1256. Prince, L.M. (2010) Phylogenetic relationships and species delimitation in Canna (Cannaceae) In: Seberg, O.. Petersen, G., Barfod, A.S. & Davis, ].I. (eds) Diversity, Phylogeny, and Evolution in the Monocotryledons. Pp. 307-331. Aarhus: Aarhus University Press. Prince, L.M. & Kress, W.J. (2006) Phylogenetic relationships and classification in Marantaceae: Insights from DNA sequence data. Zaxon 55: 281-296. Rambaut, A. (1996) Se-Al (v2.0all) Seguence Alignment Editor. http://tree.bio.ed.ac.uk/ software/seal/ (accessed 26 Nov. 2012). Rao, A.S. & Verma, D.M. (1974) Curcumorpha—a new genus of Zingiberaceae. Bull. Bor. Surv. India 13: 339-341. Ridley, H.N. (1924) The Flora of the Malay Peninsula 4: 246-252. London: Reeve & Co. Ronquist, F. & Huelsenbeck, J.P. (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572-1574. 92 Gard. Bull. Singapore 65(1) 2013 Sakai, S. & Nagamasu, H. (2006) Notes on inflorescence structure of Boesenbergia (Zingiberaceae). Acta Phytotax. Geobor. 57: 107-111. Schlechter, R. (1913) Die Gattungen Gastrochilus Don. und Gastrochilus Wall. Feddes Reper. Spec. Nov. Regni Veg. 12: 315-317. Schumann, K. (1904) Zingiberaceae. In: Engler, A. & Prantl, K. (ed) Das P/lanzenreich IV, 46, Heft 20: 91-95. Leipzig: Engelmann. Schwarz, G.E. (1978) Estimating the dimension of a model. Ann. Star. 6(2): 461-464. Smith, R.M. (1981) Zingiberaceae Synoptic Key, Royal Botanic Garden Edinburgh. (RBGE distribution, unpublished). Struck, T.H. (2007) Data congruence, paedomorphosis and salamanders. Front. Zool. 4: 22.Swoftord, D.L. (2002) PAUP*: Phylogenetic Analysis Using Parsimony (*and other methods), vers. 4.0b10., Sunderland, Massachusetts, USA: Sinauer Associates, Inc. Techaprasan, J]., Ngamriabsakul, C., Klinbunga, S., Chusacultanachai, S., & Jenjittikul, T. (2006) Genetic variation and species identification of Thai Boesenbergia (Zingiberaceae) analyzed by chloroplast DNA polymorphism. J. Biochem. Mol. Biol. 39: 361-370. Valeton, T. (1918) New notes on the Zingiberaceae of Java and Malaya. Bu//. Jard. Bor. Buitenzorg, Ser. 2, 27: 81-105. Vanijajiva, O., Suvachittanont, W. & Sirirugsa, P. (2003) Isozyme analysis of relationships among Boesenbergia (Zingiberaceae) and related genera in Southern Thailand. Biochem. Syst. Ecol. 31: 499-511. Vamijajiva, O., Suvachittanont, W. & Sirirugsa, P. (2005) Isozyme analysis of relationships among Boesenbergia (Zingiberaceae) and related genera by RAPD. Biochem. Syst. Ecol. 33: 158-170. Voigt, J]. (1845) Hortus Suburbanus Calcuttensis. Pp. 571-572. Calcutta: Bishop's College Press. Wallich, N. (1829) P/antae Asiaticae Rariores 1: 22-23. London: Treuttel & Wiirz. Wallich, N. (1832) A Numerical List of Dried Specimens (“Catalogue "). London: Wallich. Wallich, N. (1840) Inventory of 51 spp. of Live Planrs Sent to kew Gardens. Kew: Wallich collection (unpublished). Winterfeld, G., Schneider, ]. & Râser, M. (2009) Allopolypioid origin of Mediterranean species in Helictotrichon (Poaceae) and its consequences for karyotype repatterning and homogenization of rDNA repeat units. Syst. Biodivers. 7: 277-295. Wu, T.L. & Larsen, K. (2000) Zingiberaceae. In: Raven, P. & Wu, T.L. (eds) Flora of China 24: 367-368. St. Louis: Missouri Botanical Garden Press; Beijing: Science Press. Ying, B., Wendel, J.F. & Song, G. (2010) Multiple patterns of rDNA evolution following polyploidy in Oryza. Molec. Phylogen. Evol. 55: 136-142. Zâveskâ, E., Fer, T., Sida, O., Leong-Skornitkovă, ]., Sabu, M. & Marhold, K. (2011) Genetic diversity patterns in Curcuma reflect differences in genome size. Bot. J.Linn. Soc., 165: 388-401. Appendix A. Botanical history of Boesenbergia longiflora. 1808: Hamilton collected two ginger specimens in Assam, India which he labelled Bang/eum sulphureum |Hamilton 12 (E) and Hamilton s.n. (Wallich 6579A, K-W, IDC microfiche 7394)]. Boesenbergia longiflora and related taxa 93 1825: 1829: 1832: 1840: 1842: 1843: 1845: 1874: 1890: 1891: 1904: 1913: 1918: 1924: 1950: D. Don published Gastrochilus D.Don (Orchidaceae). Wallich published Gastrochilus Wall. (Zingiberaceae) with two species, G. pulcherrima Wall. (Wallich 6588, IDC microfiche 7394) and G. /ongiflora (Wallich 6589A, IDC microfiche 7394). The detailed descriptions were accompanied by watercolour illustrations. Wallich re-determined Bangleum sulphureum (Hamilton s.n... K-W, IDC microfiche 7394) to Alpinia hamiltoniana Wall. nom. nud. and identified Wallich 240 (K-W, IDC microfiche 7394) from Bengal as the same species, grouping them under Wallich 6579, A and B, consecutively. Wallich dispatched 51 species of living plants from the Calcutta Botanical Gardens to the Kew Gardens. On the inventory (Wa/lich 1840) the last two items listed are G. pulcherrima and G. jenkinsii Wall. nom. nud. Hooker published, “Gasrrochilus pulcherrima. Handsome-flowered Gastrochilus” in Curtis's Botanical Magazine (t. 3930). Hooker published “Gastrochilus longiflora. Long-flowered Gasrrochilus” in Curtis's Botanical Magazine (t. 4010). The description was accompanied by a hand-coloured plate prepared by William Hood Fitch (Fig. 2). Hooker mentioned that both G. pulcherrima and this species came to Kew Gardens as living plants from Wallich at the Calcutta Botanical Gardens. Voigt, documenting the plants at the Calcutta Botanical Gardens described the G. longiflora flower as “largish, pale-yellowish, with a rose-coloured lip” and mentioned that G. jenkinsii is from “Assam and the hills about Gowhatti. Flowered in July 1838.” Note: This places G. jenkinsii in cultivation at the Calcutta Botanical Gardens Just prior to Wallich's 1840 dispatch of plants to Kew Gardens. King collected King 1020 (CAL) in “Sikkim Himalaya.” Accompanying the specimen are two watercolour illustrations by Edward King, annotated as G. /ongiflora. Baker listed and briefiy described six Gasrrochilus species and three “Imperfectly known and undescribed species.” He revised part of Wallich's original description of G. longiflora stating “staminodes white rather longer than the white corolla-segments lip tinged with red.” He also mentioned, “The Bot. Mag. plant is G. jenhinsii, Wall. mss. and has larger flowers than that figured by Wallich, of a purer white, the lip tipped with bright red.” He broadly expanded the distributional range after annotating other specimens as G. longiflora. Kuntze observed that Gastrochilus D. Don had priority over Gasrrochilus Wall. and proposed Boesenbergia Kuntze for the later homonym. Schumann listed six known and three imperfectly known Gastrochilus species, describing G. longiflora as white flowered. Note: Schumann's Fig. 13 is wrongly labelled “Gastrochilus longiflorum”. It is an exact copy of G. pulcherrima, t. 3930 (Hooker 1842). Schlechter accepted Boesenbergia Kuntze, listing 23 taxa. Valeton reviewed 17 Indonesian Gastrochilus species, commenting on the close affinity of G. angustifolia Hallier f. (Sumatra) to G. longiflora. Ridley listed 24 Gasrrochilus species for the Malay Peninsula, noting G. longiflora only as a cultivated plant in Penang Gardens. Holttum provided an account of Boesenbergia tor the Malay Peninsula, selecting B. pulcherrima as the type. He commented that the illustration, t. 4010 in Curtis's Botanical Magazine (Hooker 1843) “does not agree very well with Wallich's” and questioned 94 Gard. Bull. Singapore 65(1) 2013 whether B. /ongiflora actually belongs to Boesenbergia or “may have to be transferred to another genus.” 1974: Rao & Verma published Curcumorpha A.S.Rao & D.M.Verma with a single species, C. longiflora (Wall.) A.S.Rao & D.M.Verma and cited 20 white-flowered specimens that reportedly diftered from Boesenbergia by having stems spurious [a false stem] spikes radical, bracts spiral and a staminodial cup. 1981: Smith supported Rao & Verma's taxonomic distinction of B. longi/lora as Curcumorpha based on the four characters. 1997: Larsen questioned the necessity of Curcumorpha, suggesting that the characters mentioned by Rao & Verma were not sufficiently different from other Boesenbergia species and recommended that C. /ongiflora be maintained in Boesenbergia. 2002: Kress et al. commented on the phylogeny of Boesenbergia suggesting that Boesenbergia might be polyphyletic with B. pu/cherrima alled to Curcumorpha. 2004: Gao et al. studied the floral biology of C. /ongiflora finding a two-day flowering cyele for the species. 2006: Sakai & Nagamasu found that a living specimen identified as B. longi/lora (Tanaka er al. 023015, TI) had an inflorescence with a distichous bract arrangement. 2003-2006: Other references to B. /ongiflora or C. longiflora include: Vanijajiva et al. 2003, 2005; Fan 2004; Techaprasan et al. 2006; and Ngamriabsakul & Techaprasan 2006. Appendix B. GenBank accession numbers (ITS/trnk) for Boesenbergia spp. (Zingiberaceae) used in this study. Sample number (voucher number, herbarium) GenBank numbers. Note: c=clone. Boesenbergia collinsii Mood & L.M.Prince: MO6PI4 (Mood 12P/7/, holotype, BK) JX992751/]X992812; MP1455 (Mood & Pedersen 1455, C) JX992752/]X992813; M2010 (Mood & Triboun 2010, BISH) ]JX992749/]X992810; M2011 (Mood & Triboun 2011, BISH) JX992750/]X992811; M3035 (Mood & MeMakin 3035, BISH) JX992753/J]X9928 14. Boesenbergia hamiltonii Mood, S.Dey & L.M.Prince: M3017 (Dey NUS53, holotype, CAL) JX992754/]X992815; M3026 (Mood 12P177, BISH) JX992755/1X992816; M3212 (Mood 12P1785, BISH) ]X992794/no data. Boesenbergia kerrii Mood, L.M.Prince & Triboun: M2044 (Mood & 7riboun 12P170, holotype, BK) JX992756/JX992817; M2049 (Mood & Chalermglin 2049, BISH) ]JX992757/ JX992818; M2058 (Mood 2055, BISH) ]JX992758/]X992819; M3009 (Mood & Triboun 3009, BISH) JX992759/]X992820. Boesenbergia kingii Mood & L.M.Prince: M3074 (Mood & Vatcharakom 12P173, holotype, BK) c2-JX992789, c3-JX992790, c4-J]X992791, cJ]X992792, c8- JX992793/ JX992829; MOSP161 (live material of Aress 03-7366, US) JX992760/J]X992821; MI11P47 (live material of Kress 96-5646, US) cl- JX992761, Ce- JX992762, c3- JX992763, c4- JX992764, c5- JX992765, c6-JX992766/ ]X992822; M2002 (Mood 2002, BISH) c1-JX992769, c2-J]X992770, c3-JX992771/J]X992825; M3015 (Mood 12P174, BISH) c1-J]X992772, c2-JX992773, c3- JX992774, c4-JX992775, c-JX992776, c12-J]X992777, c13-JX992778/JX992826; M3019 (Mood 12P175, B1ISH)c1-J]X992779,c3-JX992780,c6-JX992781,c8-J]X992782,c9-]X992783, c10-JX992784/]X992827; M3020 (Mood 12P176, BISH) c7-JX992785, c8-J]X992786, c9- JX992787, c12-JX992788/JX992828; M3272 (Mood & Vatcharakom 3272, BISH) JX992795/ JX992830; MI11P77 (live material of Newman 980, E) JX992767/1X992823; MI1P78 (live Boesenbergia longiflora and related taxa 95 material of Newman 990, E) ]JX992768/]X992824; K97-5821 (Kress 97-5821,US) AF478742/ AF478842. Boesenbergia longiflora (Wall.) Kuntze: M11P48 (live material of KXress 03-7305, US). cl- JX992796, c5-J]X992797, c6-]X992798/ JX9928311. Boesenbergia maxwellii Mood, L.M.Prince & Triboun: M2032 (Mood & Triboun 12P172, holotype, BK) JX992800, JX992833; MP1450 (Mood & Pedersen 1450, C) JX992802 JX992802; M2017 (Mood & Triboun 2017, BISH) JX992799/]X992832; M2040 (Mood & Triboun 2040, BISH) JX992801/]X992834; MI11P26 (Mood 11P26, BISH) JX992803 JX992835; M11P124 (Mood 11P124, BISH) JX992804/JX992836; MI1C132 (Funakoshi s.n., MBK) JX992805/JX992837; MI1C133 (Funakoshi s.n., MBK) JX992806/]X992838. Boesenbergia plicata var. lurida (Ridl.) Holttum: M3120 (Mood & Varcharakom 3120, BISH) JX992808/JX992839. Boesenbergia plicata var. plicata (Ridl.) Holttum: M3177 (Mood & Vatcharakorn 3177, BISH) ]JX992807/]X992840. Boesenbergia pulcherrima (Wall.) Kuntze: MO05P276 (Mood 08P276, BISH) J]X992748/ JX992809; K98-6220 (Kress 98-6220, US) AF478725/AF478825. [imi ei ie A . Po zi aa! D ne d lasa ti piete Lai Ai! Ama 0lits Si Mimi pin lui că i "coama inere otet AUR „Vi m: A orga a a MIRA tă SAUNA ai TA eat CI 4 Met at As, > ovale Aettăă i vla ko Ec i e PP yet DS Yi! 9 . 14 DEN Să A soi ——. > E ET i sii per al Ea FE au pat e oua bestia le Aucaie ADS AN Na) ai Li Pe parent dd [3 VA Dă 9 nt MIN TUIA pace ps mie e Wa mt ÎN E e EX [] A 4 Aztec UTP Oi ..: ş aj, îi atit sii Wass | 1410 AAA A Nr JXOL fl $ 4 ED se pia + 40% PAID E L | Li păi sed aid eee Ă pu pi D A ia i E: ta, Lai Pip h EM LEE + d P'-9P pi DD ELF. 84), E i -, 1-2 pata ASPIRA 4% 3 4/7 "ra 1 1% Gardens” Bulletin Singapore 65(1): 97-100. 2013 97 Valid publication of Boesenbergia aurantiaca (Zingiberaceae) Mark F. Newman Royal Botanic Garden Edinburgh, 20A Inverleith Row, Edinburgh EH3 SLR, Scotland m.newman(4rbge.ac.uk ABSTRACT. The reason why Boesenbergia aurantiaca was invalidly published is given and the name is validated here. Keywords. Borneo, Danum Valley, gingers, Sabah, type specimen Introduction In 1985, during construction of the Danum Valley Field Centre in Sabah, G.C.G. Argent and J.A. Ratter of the Royal Botanic Garden Edinburgh visited the area and made collections of herbarium specimens and living material for cultivation in Edinburgh. Among the living collections were two Zingiberaceae which were registered in the RBGE Garden Accessions book for 1985 on 15* May, when they were given accession numbers 19850843 and 19850847. The Garden Accessions book records that this was plant material collected by Argent and Ratter during March 1985. Accession number 19850843 is still growing in Edinburgh while 19850847 is assumed to have died. Among the dried herbarium specimens, which were collected under the Sandakan herbarium collection number series, was Argent, Ratter, Leopold, Dongop & Kumin SAN 108235, collected on 25 February 1985. Boesenbergia aurantiaca R.M.Sm. was one of a number of new species published by R.M. Smith in her review of the Zingiberaceae of Borneo (Smith 1987). It appeared in the Notes from the Royal Botanic Garden Edinburgh 44(2): 226 (1987), and was diagnosed and described in Latin. The type collection is cited as follows, “Type: Sabah, Danum Valley, 100-250 m, mixed dipterocarp forest, in deep shade, iv 1985, Argent & Ratter San 108235, cult. RBG Edinb., viui 1985 (holo. E).” In the herbarium at E, there are two herbarium sheets and a spirit collection which are relevant to the protologue of Boesenbergia aurantiaca. Argent et al. SAN 108235 consists ofa leafy shoot with an inflorescence and, in a capsule attached to the sheet, a fragment of leaf. The label shows differences in the collectors” names, the date of collection, and the altitude from those cited in the protologue. This sheet bears the barcode number e00389050. There is a duplicate of this collection at SAN. The other sheet consists of a leafy shoot with an inflorescence and a flower, and bears the barcode number e00149734. The collector is not recorded but is likely to have 98 Gard. Bull. Singapore 65(1) 2013 been R.M. Smith. There is no collection number but there is a reference to the living accession from which it was made, 19850847. In the capsule attached to the sheet are a smaller capsule marked, “Boesenbergia (Danum Valley plant)”, which contains dried, dissected parts of a flower, and a sheet of card with two flower dissections glued to it. The dissection at the left is marked, “wild coll.” while that on the right is marked, “cult. plant”; the bottom of the card is marked, “Argent & Ratter SAN 108235”. This sheet is a mixed collection consisting of parts from the living collection at RBGE and a part from the wild collection Argent er al. SAN 108233. The label on this sheet records the following: Observations in cultivation Orange flowers. Cultivated plant has corolla tube c.4 cm long; wild collection shows tubes of up to 7 cm. Leaves dark green with a yellowish “cloud”. Details of original collection Sabah, Danum Valley, 100-250 m, mixed dipterocarp forest in deep shade, April 1985, Argent & Ratter San 105235 (material in spirit coll.) RBGE No. 850847. RBGE number 850847 is the accession number, now always given in full as 19850847. The database ofthe living collection at E records this accession as having been collected by G.Argent & J.Ratter s.n., 15 March 1985 but, as stated in the introduction above, the Garden Accessions book gave the date simply as March 1985. When the Garden Accessions books were digitised, the database may have created the date 1Sth March 1985 automatically (R. Cubey pers. comm.). Argent's field book indicates that he and Ratter were already in the Danum Valley on 25 February and stayed there until 14 March 1985 (G.C.G. Argent pers. comm.) so Smith's record of the original collecting date as April 1985 on the holotype is a mistake. Living accession 19850847 was alive in 1992 but could not be located in November 1998 and has not been seen since; it is assumed dead. The spirit material is stored in a 500 ml jar with barcode number e0038900$5. It is important to know whether this material was collected in the Danum Valley, along with the wild collected herbarium material, or from one of the living accessions at the Royal Botanic Garden Edinburgh. The fact that the spirit bottle contains an original collecting tag from the Sandakan herbarium indicates clearly that the spirit material was collected in the wild (G.C.G. Argent pers. comm.) The herbarium sheet and the spirit material are not labelled as being parts of one specimen, however, so they must be treated as duplicates (McNeill et al. 2006, Art. 8.3). Smith (1987) regarded the cultivated specimen collected in August 1985 as the holotype, indicated by the word “holotype” in red crayon in Smith's hand on the sheet. As this sheet is a mixed collection, with parts from two gatherings, however, the name Boesenbergia aurantiaca was not validly published. The evidence available now indicates that Smith based her description mainly on the plant cultivated at Edinburgh, with supplementary notes from the spirit collection, Argenr & Ratter SAN 108235 (E). There is no evidence one way or the other that she studied the herbarium sheet of Argent & Ratter SAN 108235 (E). Thus, the name can be validly published here, as follows: Boesenbergia aurantiaca, valid publication 99 Boesenbergia aurantiaca R.M.Sm., sp. nov. floribus aurantiacis et habitu caespitoso B. ornatae similis sed foliis fusco-viridibus et pallide luteo-viridibus et ligula multo breviore distincta. R.M. Smith (in Notes Roy. Bot. Gard. Edinburgh 44: 226-227, t. 4. 1987). TYPUS: Anon. (R.M. Smith?) s.n., barcode no. e00149734, excluding dissected flower of Argent, Ratter, Leopold, Dongop & Kumin SAN 105235 in capsule, RBGE living collection, Aug 1985, taken from a living plant originally collected in Malaysia, Sabah, Lahad Datu District, Ulu Sg. Segama, Danum Valley Research Centre and grown at RBGE under accession number 19850847 (holo E). Erect herb. Leafy shoots cespitose, leaves 4-5. Leaves with petioles 2-8 cm long; lamina 5—12 x 3-5 cm, elliptic, apex shortly acuminate, glabrous, tawny green, brightly greenish yellowish variegated along the midrib; ligule 3-5 mm long, bilobed; sheaths glabrous. Inflorescence terminal on the leafy shoot, more or less sessile, many- flowered; bracts distichous, to 5 x 0.5 cm, cymbiform, glabrous, single-flowered; bracteoles smaller than the bracts; flowers orange; calyx 5-6 mm long, 2-—3-lobed; corolla tube to 7 cm long (shorter in cultivated plants), lobes 1.5-1.8 cm long, the dorsal one broader; labellum c. 2 * 2 cm, saccate, more or less entire; lateral staminodes 1.3—1.5 x 0.4—0.6 cm, spathulate. Stamen to 1.5 cm long; filament c. | cm long; anther thecae c. 0.5 cm, parallel, dehiscing by slits, connective prolonged into a | mm long crest; style glabrous; stigma glabrous. Epigynous glands 2-3 mm long, linear. Ovary 2-3 mm, trilocular with axile placentation. Capsule unknown. Other specimens seen: MALAY SIA. Sabah. Lahad Datu District, Ulu Sg. Segama, Danum Valley Research Centre, 25 Feb 1985, Argent, Ratter, Leopold, Dongop & Kumin SAN 108235 (E, including spirit collection, SAN); ibid., East trail E1, damp dipterocarp forest, 13 Oct 1985, Still SAN 112115 (E). Ecology. Deep shade in lowland mixed dipterocarp forest, at 100-400 m alt. Notes: Two herbarium specimens have been made from the surviving RBGE living accession, number 19850843, namely Neamriabsakul 29 (E) and Newman & Skornickovă 1471 (E). Images of all Zingiberaceae specimens housed at E may be seen at the herbarium database of the RBGE, http://elmer.rbge.org.uk/bgbase/vherb/ bgbasevherb.php. Smith”s Latin description of this species has not been translated into English. Since Latin is less widely read than formerly, a translation into English is given (above). ACKNOWLEDGEMENTS. 1 am grateful to D.J. Middleton (E) for useful advice on what constitutes a valid description and for permission to reprint the Latin diagnosis of Boesenbergia aurantiaca from the Notes RBG Edinburgh 44: 226 (1987), and to ]. Pereira (SAN) for locating Argent et al. SAN 108235 at SAN and for sending me a photograph of it. The improvements suggested by the reviewers, J. McNeill (E) and J. Leong-Skornitkovă (SING), are also gratefully acknowledged. 100 Gard. Bull. Singapore 65(1) 2013 References MceNeill, J., Barrie, F.R., Burdet, H.M., Demoulin, V., Hawksworth, D.L., Marhold, K., Nicolson, D.H., Prado, J., Silva, P.C., Skog, J.E., Wiersema, J.H. & Turland, N.J. (eds) (2006) International Code of Botanical Nomenclature (Vienna Code) adopted by the Seventeenth International Botanical Congress, Vienna, Austria, July 2005. Ruggell: A.R.G. Gantner Verlag KG [Regnum Veg. vol. 146]. Smith, R.M. (1987) A review of Bornean Zingiberaceae: III (Hedychieae). Votes Roy. Bor. Gard. Edinburgh 44: 203-232. Gardens” Bulletin Singapore 65(1): 101-105. 2013 101 Aspidistra jiewhoei (Asparagaceae), a new species from north Vietnam Hans-Juergen Tillich! and Jana Leong-Skornikovă& 'Ludwig-Maximilians-University, Systematic Botany, Menzinger Str. 67, D-80638 Munich, Germany hjtillich(4 gmx.de “The Herbarium, Singapore Botanic Gardens, 1 Cluny Road, 259569 Singapore jana_skomickova(a seznam.cz ABSTRACT. An unusual new species of Aspidistra Ker Gawl. (Asparagaceae: Nolinoideae) from north Vietnam, A. jiewhoei Tillich & Skorni€k. is described and illustrated here. Keywords. Asparagaceae, Aspidistra, Nolinoideae, Vietnam Introduction The genus Aspidistra Ker Gawl. (Asparagaceae: Nolinoideae) is distributed from Assam (India) in the west to southern Japan in the east, and from Central China southwards to the Malay Peninsula, but the centre of diversity is SE China (Guangxi Province) and adjacent northern Vietnam (Tillich 2005). During the past three decades the number of known species has increased considerably from 11 in 1980 to more than 100 (Tillich & Averyanov 2012), with many novelties reported in last decade from Vietnam (Bogner & Arnautov 2004; Brăuchler & Ngoc 2005; Tillich 2005, 2006; Tillich et al. 2007; Tillich & Averyanov 2008, 2012; Averyanov & Tillich 2012, in press). The total number of known species in Vietnam is currently 37, but as most of the Aspidistra species seem to be stenoendemic, it is expected that with continuing floristic explorations its numbers will grow progressively. The first author has been extensively involved with taxonomy of the genus Aspidistra, and provided a comprehensive key to the genus covering 93 species (Tillich 2008). So when an unidentified Aspidistra species flowered in the living collections of Singapore Botanic Gardens it was brought to his attention by the second author. It was clear that this unusual species endowed by several unique morphological features represents a new species and is here described below. In line with the collecting practices as outlined by Tillich (2005), the spirit conserved flower is part of the type specimen as well as colour photo documentation of important characters including the flower dissection. 102 Gard, Bull. Singapore 65(1) 2013 Aspidistra jiewhoei Tillich & Skorni&k., sp. nov. Similar to A. /ateralis Tilhch, but differs by its stamens overtopping the stigma surface, the pistil closely attached to the perigone wall, and the growth form with upright shoots, bearing the flowers on short peduncles in lateral position and clearly above ground level. TYPE: Jana Leong-Skornickovă JLS-1871, Cultivated in the Singapore Botanic Gardens (SBG Acc. No. 20122069), 5 Dec 2012 (holo SING, including flowers in the liquid collection; iso M, HN, both including flowers in the liquid collection). Originally from Northern Vietnam, TuyEn Quang Province, Nă Hang District (collector unknown), donated to Singapore Botanic Gardens by the Singapore Gardening Society. (Fig. 1 & 2.) Rhizomatous herb up to 35 cm tall. Rhizome with very short internodes, diameter 10-13 mm. Leaves crowded, cataphylls deep purple when young, up to 12.5 cm long. Petiole 10-20 cm long, stout, stiff, ventrally with a furrow, deeper at apical part, shallower towards the base, basal 5-12 mm swollen. Blade broadly ovate, slightly unequal, 20-30 x 8.5-13 cm, apex acuminate, base rounded, matt dark green above (nearly dark bluish green), light grey-green beneath with strongly protruding midvein and well-visible dark green secondary veins, margin very minutely serrate, making the margin somewhat sharp to touch, revolute. Peduncle up to 4.5 cm long, semi-erect at first, later more or less horizontal or descending when the flower opens, its tip bent downward, dark purple externally, with 3 hood-lke, dark purple scales, 2 subtending the flower and 1 along the scape. Perigone nodding, widely bowl-shaped, 14-15 mm in diameter, with nearly flat, fleshy base, reddish purple to deep purple internally and externally, except sometimes outer basal part lighter (cream-yellowish). Lobes 6 (sometimes 8), ovate-triangular, erect to slightly patent, upper surface smooth, in two whorls of 3 (sometimes 4), outer lobes c. 6-7 x 8-9 mm, inner lobes c. 5-6 x 6-7 mm. Stamens 6 (8 in flowers with 8 lobes), inserted at apical part of the tube, overtopping stima surface, anthers sessile, somewhat sunken in a circular bulge, anther thecae c. 1.3 mm long, bean shaped, separated by light green connective tissue, pollen bright yellow. Pistil depressed obconical, c. 3 mm high, outer (lower) surface closely attached to perigone wall. Stigma circular, 5-6 mm in diameter, cream-coloured in the slightly convex centre, margin and lower part tinged with purple red to deep purple, the margin with small lobes. Fruir unknown. Ermology. We name this species in honour of Mr. Tan Jiew Hoe, president of Singapore Gardening Society, for his continuous support of botanical and horticultural research in Singapore as well as in other parts of Asia, particularly in Laos and Vietnam. It was him who first brought this unusual plant to our attention and donated several individuals to the research collections of Singapore Botanic Gardens, where it flowered. Notes. This species can be readily recognised by stamens overtopping the stigma surface and the obconical pistil, which, by its outer (lower) surface, is closely attached to the perigone wall, lacking any space in between (Fig. 2 A, D, F). The latter feature is so far unique in the genus. The flowers are superficially similar to A. /ateralis Tilheh 104 Gard. Bull. Singapore 65(1) 2013 Fig. 2. Floral characters of Aspidistra jiewhoei. A. Dissection of the flower & detail of the basal part of the flower (scale in mm). B. Trimeric flower (front view; cultivated in deep shade condition). C. Trimeric flower (side view; cultivated in deep shade condition). D. Tetrameric flower with 8 lobes and 8 anthers (front view; cultivated in deep shade condition). E. Trimeric flower (side view; cultivated in semi-shade condition). F. Trimeric flower (front view: cultivated in semi-shade condition). (Photos: J. Leong-Skornikovâ) New Aspidistra from Vietnam 105 from Thua Thi&n-Hu& Province, but in that species the stamens are below stigma level, and it differs clearly by its remarkable growth form with upright shoots, bearing the flowers on short peduncles in lateral position clearly above ground level. It has been observed that trimeric (6 lobes, 6 stamens) as well as tetrameric flowers (8 lobes, 8 stamens) are produced on a single plant. This phenomenon has been reported in Aspidistra before, e.g. A. lateralis Tilhch, 4. guangxiensis S.Tang & Y.Liu, and A. leshanensis K.Y.Lang & Z.Y.Zhou. It is also noticeable that plants cultivated in deep shade produced slightly smaller flowers on longer peduncles, which were darker in colour (Fig. 2 B-D), compared to the plants cultivated under semi-shade conditions, which produced larger, overall slightly more robust flowers, with lighter coloration (Fig. 2A&E-F). ACKNOWLEDGEMENTS. The research of the second author is funded by the National Parks Board, Singapore and the Czech Science Foundation, GACR (grant nos. $21/09/0202 and P506/10/0623). References Averyanov, L.V. & Tillich, H.-J. (2012) New taxa of Aspidistra (Asparagaceae) from Central Vietnam. Țurczaninowia 15: 5-10. Averyanov, L.V. & Tillich, H.-J. (in press) Aspidistra truongii — a new species of Asparagaceae (Convallariaceae s.str.) from Southern Vietnam. 7aiwania 59. Bogner, ]. & Arnautov, N.N. (2004) Aspidistra locii (Convallariaceae), an unusual, new species from Vietnam. Wil/denowia 34: 203-208. Brăuchler, C. & Ngoc, L.H. (2005) Aspidistra renatae (Ruscaceae) — A new species from Central Vietnam. Blumea 50: 527-529. Tillich, H.-J. (2005) A key for Aspidistra (Ruscaceae), including 15 new species from Vietnam. Feddes Repert. 116 (5-6): 313-338. Tillich, H.-J. (2006) Four new species of Aspidistra (Ruscaceae) from China, Vietnam, and Japan. Feddes Repert. 117: 139-145. Tillich. H.-J. (2008) An updated and improved determination key for Aspidistra Ker-Gawl. (Ruscaceae, Monocotyledons). Feddes Repert. 119: 449-462. Tillich. H.-J. & Averyanov, L.V. (2008) Two new species and one new subspecies of Aspidistra Ker-Gawl. (Ruscaceae) from Vietnam. Feddes Repert. 119: 37-41. Tillich. H.-J. & Averyanov, L.V. (2012) Four new species of Aspidistra Ker-Gawl. (Asparagaceae) from China and Vietnam with a comment on A. /ongifolia Hook.f. and A. hainanensis W.Y.Chun & F.C.How. Gard. Bull. Singapore 64(1): 201—209. Tillich, H.-J., Averyanov, L.V. & Dzu, N.V. (2007) Six new species of Aspidistra (Ruscaceae) from northern Vietnam. Blumea 52: 335-344. 4 a 3 | Pt 107 706 a UN d d da] a. a Pi LU MAR a, ij Di ij 2 vă bsa Gardens” Bulletin Singapore 65(1): 107-114. 2013 107 Rubovietnamia sericantha (Rubiaceae: Gardenieae), a new combination and notes on the genus in China Y.H. Tong'?, W.B. Xu:, Y.F. Deng!, K.M. Wong+ and N.H. Xia' 'Key Laboratory of Plant Resources Conservation & Sustainable Utilization, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, 510650, People's Republic of China yh-tong(ascbg.ac.cn, yfdeng(a/scbg.ac.cn (corresponding author), nhxia(ascbg.ac.en "University of Chinese Academy of Sciences, Beijing 100049, People's Republic of China *Guangxi Institute of Botany, Guangxi Zhuang Autonomous Region & Chinese Academy of Sciences, Guilin, 541006 Guangxi, People's Republic of China gxibwbxu(4 gmail.com “Singapore Botanic Gardens, 1 Cluny Road, Singapore 259569 wkm2000(2 gmail.com ABSTRACT. Porterandia sericantha, originally published as Randia sericantha, is re- combined as Rubovietnamia sericantha. Because of its earlier published specific epithet, it is the correct name for the generic type, Ruboviernamia aristata. Rubovietnamia consists of two species distributed in SW China and N Vietnam. Keywords. China, new combination, nomenclature, Porterandia, taxonomy, Vietnam Introduction Porterandia Ridl. (1940: 593), a small genus of the Gardenieae in Rubiaceae, consists of about twenty species distributed in Peninsular Thailand, west Malaysia and Sulawesi with the centre of diversity in Borneo (Puff et al. 2005, Zahid & Wong 2010). It is characterised by distinctly sheathing stipules, a densely bristly corolla tube outer surface, absence of (or at most minute) hairs on the inner surface of the corolla-tube, and included anthers and style (Zahid & Wong 2010). Porterandia sericantha (W.C.Chen) W.C.Chen (1999: 384) is the only species ascribed to the genus in China. It was originally described as Randia sericantha W.C.Chen (1987: 298) based on collections from the Guangxi and Yunnan provinces, SW China (Fig. 1). Zahid & Wong (2010) pointed out that it is quite different from typical Porterandia in having the stipules just slightly fused at the base and not forming a distinct tubular sheath, a sparsely hairy corolla tube outer surface, long flexuous hairs on the inner surface of the corolla tube, and exerted anthers and style. They (Zahid & Wong 2010) excluded this species from Porterandia, but did not place it into any genus. In fact, these characters of the species conform well to Ruboviemnamia Tirveng. (Tirvengadum 1998: 166). 108 Gard. Bull. Singapore 65(1) 2013 Rubovietnamia The genus Rubovienamia was established with the sole species R. aristata Tirveng. (Tirvengadum 1998: 167) based on collections from northern Vietnam. Later, A. aristata was also reported from Yunnan and Guangxi, China (Zhang et al. 2007). The genus differs from Vidalasia Tirveng. in having typically 2—8-flowered cymes (sometimes reduced to single flower), subentire stipuliform bracts and bracteoles, and 2-4 ovules and seeds (Tirvengadum 1998, Zhang et al. 2007, Chen & Taylor 2011). Vidalasia has many-flowered compound cymes, erose-setose stipules and bracts, and numerous ovules and seeds. Mou & Zhang (2010) suggested a sister relationship between Ruboviernamia and Duperrea Pierre ex Pitard (1924: 334) based on combined sequences of two chloroplast markers, but they were unable to test the relationship between Ruboviernamia and Vidalasia, implied by Tirvengadum (1998) as close. In China, the distribution recorded for Porterandia sericantha overlaps with Rubovietnamia aristata, sharing a similar habitat. Also, these two species are very difficult to distinguish by the illustrations provided by Chen (1987, 1999) and Tirvengadum (1998), respectively. Chen (1987, 1999) included a line illustration for the species, which incorrectly depicts an unequally bi-lobed stigma. After examining the type material, it was found that the stigma is club-like, grooved, with 2 equal lobes initially cohered together (Fig. 1). Zhang et al. (2007) had studied and noted specimen material identified by Tirvengadum when they reported R. aristata in China. We have checked an image of the type of A. aristata, and have examined all specimens cited by Zhang et al. These and Porterandia sericantha in Chinese herbaria represent the same species. At the specific rank, the epithet “sericantha” has priority over “aristata”, so that the new combination, Ruboviernamia sericantha, is necessary (see below). Mou & Zhang (2010) described a second species, Ruboviernamia nonggangensis F.J.Mou & D.X.Zhang (2010: 123), from Guangxi, China. It difters from R. aristata Tirveng. in having much broader foliaceous calyx lobes, and the leaves, young branches and flowers (including pedicels, ovary, styles and calyx) densely covered with hairs. Rubovietnamia sericantha (W.C.Chen) Y.F.Deng, Y.H.Tong, W.B.Xu & N.H.Xia, comb. nov. Basionym: Randia sericantha W.C.Chen, Guihaia 7: 298 (1987). — Porterandia sericantha (W.C.Chen) W.C.Chen, FI. Reipubl. Popularis Sin. 71(1): 384 (1999); FI. Yunnan. 15:192 (2003); Chen & Taylor, FI. China 19: 292 (2011). TYPE: China, Yunnan, Xichou Xian, Xinjie, 1200 m, 10 June 1964, Wang 903 (holo KUN; 1so KUN). (Fig. 2) Rubovietnamia aristata Tirveng., Biogeographica 74: 167 (1988); Zhang et al., Acta Phytotax. Sin. 45: 91 (2007); Chen & Taylor, FI. China 19: 320 (2011); synon. nov. TYPE: Vietnam, Hoa Binh, Paco, Mai Cheu, 19 November 1997, Bastien & Doa 22bis (holo P; iso HN). Shrubs or small trees, 1-6 m tall. Bark covered with variously shaped lenticels. Young branches compressed to terete, glabrous or moderately to densely ferruginous Rubovietnamia in China 109 cp E PLZ PFA PI RAE 3 Mg: tf: E f: De == II LLEză i imite i = RX E IES 015308 EA ați H+ Fig. 1. Holotype of Ruboviernamia sericantha. Courtesy of the herbarium of the Kunming Institute of Botany, Chinese Academy of Sciences (KUN). 110 Gard. Bull. Singapore 65(1) 2013 -g te => Zi [) „E 3 să :j8 - SA (SI 4 sd = miza 7719 A le tera Apare Piti ui Sp UI Fig. 2. Ruboviernamia sericantha. A. Flowering branch. B. Portion of stem showing stipules. C. Flower with calyx and corolla. D. Calyx slit and spread out. E. Corolla slit and spread out. F. Stamen. G. Ovary and style. H. Fruiting branch. A-G from Wang 903 (KUN), H from Ching 6401 (BSC). (Drawn by Wang Ling.) Rubovietnamia in China Il] hirtellous. Stipules ovate to triangular, 5-7 mm, chartaceous, moderately to densely strigillose to hirtellous or glabrous, terminating with two minute interpetiolar limbs. Leaves opposite; petiole 3—15 mm, moderately to densely pilosulous or hirtellous to glabrescent; leaf blade elliptic, oblanceolate, oblong or obovate, 4-18 x 1.5-5 cm, drying papery, adaxially sparsely strigillose to subglabrous, abaxially sparsely to densely pilosulous or hirtellous, base cuneate to obtuse, margin entire, apex acute to usually short-acuminate, often appearing aristate; lateral veins 7-14 pairs, with pilosulous domatia in abaxial axils, abaxially inconspicuous, adaxially prominent. Inflorescences cymose, 2-—5.5 x 3-5 cm, (1l—)3-5-flowered, basically terminal but occupying a pseudo-axillary position because of sympodial growth; pedunele (0—)1-5 mm, densely pilosulous to hirtellous; bracts triangular, lanceolate or stipuliform, 2.5— 3 mm long, apex acute to acuminate. Flowers with pedicels 0.5—1.7 cm; bracteoles minute, 1-2 mm long, hirtellous; calyx tube campanulate, 0.7—1 cm long, densely pilosulous and/or strigose, lobes 5, valvate in buds, ovate-oblong, 5-7 mm long, apex acute, with the central nerve dorsally ending into an arista, margin ciliate; corolla white, outside densely yellow sericeous, tube cylindrical, 2—2.2 cm long, inside glabrous except with a villous ring at middle, lobes 5, ovate to ellptic, 1—1.2 x 0.5-0.6 cm; stamens 5, inserted near the throat, exerted, filaments absent or inconspicuous, anthers linear, adnate, dorsifixed, 3—5 mm long, apex acute; ovary hirtellous, 1-locular, ovules 4; style subeylindrical, c. 2.5 cm long, hirsute; stigma bifid, 2-3 mm long, striate. Fruit a berry, subglobose, 1-—1.7 cm in diam., pilosulous to strigillose; seeds about 4, ovoid or subglobose, 4-7 mm across. Distribution. The species is distributed in N Vietnam and SW China (Guangxi and Yunnan) (Fig. 3). Ecology. Rubovietnamia sericantha grows in forests or thickets at streamside in valleys, and also on slopes of limestone hills at elevations of 200-—1500 m. It was observed flowering from May to June and fruiting from July to October. Additional specimens examined: CHINA. Guangxi. Baise Shi, Youjiang Qu, Daleng Xiang, Longhe Cun, 8 Jun 1977, Huang 3-22060 (GXMI), 10 Jun 1984, Chen 37019 (GXMI); Daxin Xian, Taocheng Zhen, Baoyuan, 13 May 1981, Chen & Ling 34194 (GXMI); Debao Xian, Longguang Xiang, 700 m, 14 Jan 1956, Expedition to Baise 1904 (|BK, IBSC, KUN), Du'an Xiang, Fushan Cun, 14 Jul 1977, Expedition to Debao 3-0466065 (GXMI, IBSC), Yandong Xiang, Qinjia Cun, 24 May 1977, Expedition to Debao 3-47363 (GXMI, IBSC), Chengguan Zhen, Hanlong Cun, 31 May 1977, Expedition to Debao 3-47384 (GXMI); Hechi Shi, 12 Jul 1928, Ching 6401 (IBSC), Jingchengjiang Qu, Baitu Xiang, Deming Cun, Jiliao, 2 Aug 1977, Lan 4-4-156 (GXMI); Huanjiang Xian, Mulun Xiang, Leyi to Donglai, 21 Oct 1991, Botanical Expedition to Yunnan, Guizhou & Guangxi 70060 (IBK, KUN), Donglai, 520 m, 18 Apr 2012, Au, Peng & Hu ML1053 (BK), Baidan Tun, Tantou, 270 m, 25 Apr 2012, Jiang, Yang & Mo 11591 (IBK), Daan Xiang, Dingxin Cun, Xiagang, 16 Aug 1977, Expedition to Huanjiang 4-3-322 (GXMI), Dongxing Zhen, Duya Cun, Caiken, 14 Aug 1977, Expedition to Huanjiang 4-3-755 (GXMI); Jingxi Xian, Renzhuang Xiang, Bangliang Cun, 750 m, 10 Sep 2006, Liu & Xu 8 (IBK), near Laolangdong, 590 m, 8 Sep 2010, Huang & Pan LYJĂ0021 (IBK), Yuexu Zhen, Daxing Cun, 850 m, Xu & Liang B0069 (IBK), Hurun Xiang, Dongpai Cun, 690 m, 20 112 Gard. Bull. Singapore 65(1) 2013 0 80 160 320 CV! Fig. 3. Distribution of Ruboviemamia sericantha (€). Sep 2010, Huang & Wu LYJX0574 (IBK), Sanhe Xiang, Gelu Cun, 840 m, 15 Sep 2010, Huang & Wu LYJX0361 (BK), Nanpo Xiang, Diding Cun, Baling Tun, 890 m, 25 Sep 2010, Huang & Wu LYJĂ0696 (IBK), Dizhai, 850 m, 21 Dec 1958, Chang 15116 (BK, IBSC), Wuping Xiang, Yixing Cun, 20 Dec 1958, Chang 14620 (IBK, IBSC), Biaolin Xiang, Tongde, Laohuaidashan, 24 Aug 1935, Ko 55605 (IBK, IBSC), Tanggang to Dean, 3 Nov 1956, Li P00815 (IBK, IBSC), Tanggang to Anzhen, roadside, on slope, 3 Nov 1956, Li 3472 (BSC), Dizhou Xiang, Fuliu Cun, 26 Jul 1977, Lin 21602 (GXMI);, Long'an Xian, Pingshan Xiang, 18 May 2005, Shui, Chen & Zhang B2005-311 (KUN, PE), 18 May 2005, Shui, Chen & Zhang B2005-325 (KUN, PE); Longzhou Xian, Jinlong Zhen, Banbi, 9 Jun 1965, Fang & Liang 21602 (GXMI), 350 m, 14 Apr 2010, Xu & Pan 10067 (IBK), 6 Jun 1977, Expedition to Longzhou 2-007 (GXMI), Longdao, 320 m, 23 Jul 2009, Huang, Ye & Li H09620 (BK), Shashu, 4 May 1956, Li 282 (IBK, IBSC), Nonggang, 230 m, 16 Jul 2009, Huang, Wu & Chen H09099 (IBK), 240 m, Expedition to Guangxi 2016 (IBK), 300 m, 7 Oct 2010, Xu & Wu LZI13 (IBK), 600 m, 10 Jul 2010, Xu & Wu 10544 (BK), Qinglongshan, 160 m, 11 Aug 2008, Expedition to Guangxi 2570 (IBK), Sanlian Xiang, 290-370 m, Expedition to Guangxi 3755 (UBK), 370 m, 16 May 2009, Huang 1109473 UBK), Xiadong Xiang, Nahua Cun, Longqin, 350 m, 15 Oct 2008, Expedition to Guangxi 3955 (IBK), Xiangshui Xiang, Siqing Dadui, Longshui, 16 Jun 1979, Expedition of Longzhou Institute of Medicine 0358 (GXMI), Zhupu Xiang, 200 m, 13 Oct 2008, Liang et al. 8268 (IBK), 21 Sep 1935, Guangxi Museum 60 (BSC), Shuikou Xiang, Shishan, 16 Sep 1958, Chang 12089 (IBSC), Paizong Xiang, Bagouniu, 380-650 m, 24 Aug 1957, Chen 13952 (BK, IBSC); Luocheng Xian, Qiaoshan Xiang, Qiaoben Cun, Lading, 26 May 1977, Expedition to Luocheng 4-1-1233 (GXMI), Huaiqun Zhen, Zhenxin Cun, Changdong, 29 May 1977, Expedition to Luocheng 4-1-1563 (GXMI), Tianhe Zhen, Beijiang Cun, 21 Jun 1977, Rubovietnamia in China 113 Expedition to Luocheng 4-1-1777 (GXMI); Nandan Xian, Baxu Xiang, Li'ao Cun, Jiuxu, 28 Sep 1977, Expedition to Nandan 4-5-828 (GXMI); Napo Xian, Baidu Xiang, Nongbu Cun, 1200 m, 20 May 198, S China Expedition 845 (IBSC), 18 Oct 1977, Fang 3-1529 (GXMI), Nonghua Cun, Nonghua, 950 m, 20 Jun 1982, Fang, Lai & Wang 25150 (GXMI), Nonglong Cun, 4 Jul 2012, Jong & Bai 12070419 (IBSC), Delong Xiang, 21 May 1959, Liang 3094 (GXMI), Pingmeng Zhen, 16 Oct 1997, Sino-Japanese Botanical Expedition to Yunnan & Guangxi of China 1114 UBK, KUN), Lengzhong Xiang, Longxu, 900 m, 3 Dec 1956, Li 3472 (IBK, IBSC), Baihe Xiang, Shanglong Cun, 27 Oct 1977, Fang 3-1573 (GXMI); Ningming Xian, Longrui, 250 m, 29 Apr 1980, Expedition to Nonggang 11897 (IBK), 300 m, 25 May 2008, Expedition to Guangxi Î181 (IBK), 110-280 m, 13 Oct 2008, Expedition ro Guanexi 3861 (BK); Yizhou Shi, Lali Xiang, Baowei Cun, Machao, Chen & Sha 55953 (GXMI), 15 May 1991, Rao 55846 (GXMI), Desheng Zhen, Xinhui Cun, 29 Sep 1977, Expedition to Yishan 4-2-1-266 (GXMI). Qianhe Cun, 2 Oct 1977, Expedition to Yishan 4-2-1-506 (GXMI). Yunnan. Hekou Xian, Nanxi Zhen, Luyingqging, 700-950 m, 21 Oct 2001, Shui er al. 15160 (KUN), Yaoshan Xiang, Dudian Cun, Baiquanchong, 760 m, 27 Oct 1954, Feng 5185 (KUN); Maguan Xian, Gulinging Xiang, Laofangzi, 103*57'53”E 22*46"49”N, 1400 m, 16 Oct 2002, Shui, Chen & Sheng 31547 (KUN, PE); Malipo Xian, Babu Xiang, Yunling Cun, Huangjinyin, 28 Nov 1964, unknown coll. 9944 (KUN), 1100 m, 20 Jan 1940, Wang 86267 (IBSC, KUN), 28 Nov 1964, Wu 9944 (KUN), 1030 m, 28 Nov 1964, Lin 658 (KUN), in 1947, Feng 13166 (KUN), 1100-1400 m, 15 Nov 1947, Feng 13259 (IBSC, KUN), 20 Aug 2012, Tong & Bai 12082012 (IBSC), Ganhe Xiang, 1100 m, 11 Nov 1951, Mao 645 (HITBC, KUN), Tiechang Xiang, Guangao, 1000 m, 14 Feb 1940, Wang 86806 (IBSC, KUN), Xiantian, 24 Nov 1963, Liu et al. 101861 (KUN), 1000 m, 3 Jan 1940, Wang 86133 (BK, IBSC, KUN), Dongding Cun, 1000-1100 m, 18 Nov 1947, Feng 13364 (IBSC, KUN), 1000 m, 4 Jan 1940, Wang 86193 (BSC, KUN), Xiajinchang, near Jiangjia Tun, 1210 m, 3 Oct 2003, Shui, Chen & Sheng 21642 (BSC, KUN, PE), 1210 m, 3 Oct 2003, Shui, Chen & Sheng 32727 (KUN, PE), Majie Xiang, 1300-1500 m, 14 Oct 1947, Feng 12484 (IBSC, KUN); Xichou Xian, Dongma Xiang, Guoditang, Dadi, 1350 m, 11 Jun 1991, Shui 891-140 (KUN), Cha-ban, 1000 m, 27 Dec 1939, Wang 86093 (IBSC, KUN). VIETNAM. Cao Bang. Trung Khanh District, Ngoc Khe Municipality, Pac Nga village, 22%54'59”N 106*31'44"E, 700-750 m, 10 Jun 2004, Avervanov, Loc, The & Vinh 5529 (MO, P). Ha Giang. Quan Ba District, Pass between Ha Giang and Quan Ba, 4-5 km outside Quan Ba, 23*06'03”N 105*01"20”E, 11 Jul 2002, van der Werff, Dao, Gray & Doan 17282 (MO, P), 17286 (MO, P). ACKNOWLEDGEMENTS. We thank the curators of the herbaria GXMI, HITBC, IBK, IBSC, KUN, MO, P and PE for their help with specimens for our studies. We are grateful to Dr. Tirvengadum (P) for providing his publication on Ruboviermnamia tor reterence, Ms. Wang Ling who prepared the line drawing, and Dr. Yu Shengxiang (PE) for his help in preparing the distribution map. References Chen, T. & Taylor, C.M. (2011) Porterandia and Ruboviemamia. In: Wu, Z.Y., Raven, P.H. & Hong, D.Y. (eds) Flora of China 19. Pp. 291-292, 319-320. Beijing: Science Press; St. Louis: Missouri Botanical Garden Press. 114 Gard. Bull. Singapore 65(1) 2013 Chen, W.C. (1987) Materials for Rubiaceae. Guihaia 7(4): 297-300. Chen, W.C. (1999) Porterandia. In: Lo, H.S. (ed) Flora Reipublicae Popularis Sinicae 71(1). Pp. 384-386. Beijing: Science Press., (in Chinese). Ridley, H.N. (1940) Notes on some Malayan Rubiaceae. Bu//. Misc. Inform. Kew 1939: 593-— 613. Mou, F.J]. & Zhang, D.X. (2010) Ruboviernamia nonggangensis (Rubiaceae), a new species from China. Bor. Stud. 51: 119-126. Persson, C. (1996) Phylogeny of the Gardenieae (Rubiaceae). Bor. J. Linn. Soc. 121: 91-109. Pitard-Briau, C.].M. (1924) Rubiacees. In: Lecomte, P.H. (ed) F/ore Generale de 1 'Indo-Chine 3. Pp. 20442. Masson, Paris. Puff, C., Chayamarit, K. & Chamchumroon, V. (2005) Rubiaceae of Thailand —A Pictorial Guide to Indigenous and Cultivated Genera. Bangkok: The Forest Herbarium, National Park, Wildlife & Plant Conservation Department. Robbrecht, E. & Puff, C. (1986) A survey of the Gardenieae and related tribes (Rubiaceae). Bor. Jahrb. Syst. 108: 63-—137. Tirvengadum, D.D. (1998) Novelties in Rubiaceae from the limestone flora of Southeast Asia. Biogeographica 744): 163-175. Zahid, M.S. & Wong, K.M. (2010) The circumscription, taxonomy and biogeography of Porterandia (Rubiaceae-Gardenieae). Edinburgh J. Bot. 67: 265-342. Zhang, M.D., Chen, W.H. & Shui, Y.M. (2007). Miscellaneous notes on the tribe Gardenieae (Rubiaceae) from China and Vietnam. Acra Phytotax. Sin. 45: 90-93. Gardens” Bulletin Singapore 65(1): 115-116. 2013 115 Additions to The Plant Taxa of H.N. Ridley, 4. The Primitive Angiosperms (Austrobaileyales, Canellales, Chloranthales, Laurales, Magnoliales, Nymphaeales and Piperales) I.M. Turner Research Associate, Royal Botanic Gardens Kew Research Associate, Singapore Botanic Gardens Correspondence address: Fairfield, Pett Level Road, Winchelsea Beach, East Sussex TN36 4ND. U.K. Turner 187(4btinternet.com ABSTRACT. Three taxa omitted from an earlier compilation are listed here. They represent names authored by Henry Ridley for varieties in the Annonaceae. One name is lectotypified. Keywords. Annonaceae, lectotype, Ridley Introduction In an oversight, three names (all at varietal rank in the Annonaceae) were omitted from a recent compilation of Henry Ridley's primitive angiosperm taxa (Turner 2012). These three taxa are listed here in the same style as the original paper. MAGNOLIALES Annonaceae ]: Oxymitra fornicata Hook.f. & Thomson var. glabra Ridl., FI. Malay Penins. 1 (1922) 80. SYNTYPES: Thailand, Pulau Adang, Ridley 15904 (lectotype, designated here, K,; isolectotype SING). Peninsular Malaysia, Penang, Anon. [Philhipps] s.n. (K). = FRIESODIELSIA DISCOLOR (Craib) D.Das, Bull. Bot. Surv. India 5 (1963) 93. Oxymitra discolor Craib, Bull. Misc. Inform. Kew 1925 (1925) 11. Sinclair, Gard. Bull. Singapore 14 (1955) 457. l. Alphonsea maingayi Hook.f. & Thomson var. elliptica (Hook.f. & Thomson) Ridl., FI. Malay Penins. 1 (1922) 98. Basionym: ALPHONSEA ELLIPTICA HOook.f. & Thomson, FI. Brit. India 1 (1872) 90. 116 Gard. Bull. Singapore 65(1) 2013 Il. Cyathostemma viridiflorum Griff. var. scortechinii (King) Ridl., FI. Malay Penins. 1 (1922) 27. Basionym: Cyarhostemma scortechinii King, ]. Asiat. Soc. Bengal, Pt. 2, Nat. Hist. 61 (1892) 9. = UVARIA GRIFFITHII L.L.Zhou et al., Syst. Biodivers. 7 (2009) 255. References Turner, I.M. (2012) The plant taxa of H.N. Ridley, 4: The primitive angiosperms (Austrobaileyales, Canellales, Chloranthales, Laurales, Magnoliales, Nymphaeales and Piperales). Gard. Bull. Singapore 64: 221-256. Gardens” Bulletin Singapore 65(1): 117-134 2013 117 Nomenclatural notes on Eugenia reinwardtiana (Myrtaceae) and more or less associated names J.F. Veldkamp National Herbarium of The Netherlands. Naturalis Biodiversity Center. PO. Box 9514, 2300 RA Leiden. The Netherlands jan-frits veldkamp E naturalis. nl ABSTRACT. The nomenclatures of Calhyptranthes ramifiora Blanco. Caryophpilus cotinifolius Miller, Eugenia bukobensis Engler. E. codyensis Munro ex Wight. E. cotinifolia Jacq.. E. elliptica Lam . E. hypoieuca Thwaites ex Kosterm „E. philhreoides Trimen. E. reimwardiiana DC.. E. TO ii DC... E. salomonica CT. White, Jossinia Comm. ex DC.. Myrtus carvophyilata L.. M_ cotini folio Plumier. M pimenia L.. and Pimenta acris (Sw.) Kostel. (Myrtaceae). and more or less associated names are outlined. Some typifications are made. Keywords. Eugenia, Myrtaceae. Myrtus. nomenclature. Pimenta. Syzwygium Introduction The generic delimitation of Eugenia L. against Syzygium J.Gaertn. (Myrtaceae) is notoriously complicated but gradually, from various disciplines, a clearer concept is evolving. For anatomy see, e.g.. Ingle & Dadswell (1953) and Schmid (1972a, b. c), and palynology (Pike 1956). Wilson et al. (2005). based on an analysis with matK. found that they are in quite different clades: Eugenia was included in the Myrteae (usually în the subiribe Eugeniinae O. Berg) and Syzygium in the new Syzygieae. It must be noted, though, that of Eugenia only E. uniflora L. was included and for Syzygium but 3 species. Similar results based on ITS and psb4-trnH were reported by Lucas et al. (2005), where the genera again were in difierent clades. However. only four Eugenia and two Syzygium species were included. Wilson restricted Syzygium (over 500 spp.) to the Old World, and Eugenia (c. 550 spp.) to the New World. Pacific. the Philippines, and Africa (2011: 245, 252). In the Philippines (Wilson 2009) there would be 10 native species and an introduced one. He accepted two species for New Guinea (Snow & Wilson 2010). The specialists apparently disagree, for according to a recent revision by Ashton (A; in litt.) there would be only two Malesian species of “true” Eugenia: E. craveniana N.Snow & Peter G.Wilson and E. reimwardtiana DC. In the Pacific the related Eugenia salomonica C.T.White ranges from Mussau Is]. (St. Matthias Group) and Bougainville to the Solomons. All other putative Eugenia would belong to Syzygium. An extract from the generic key by Wilson (2011: 227-228) compared to the generic descriptions gives the following key, which clearly 1s polythetic: 118 Gard. Bull. Singapore 65(1) 2013 Young shoots and flowers often pubescent. Inflorescences usually axillary, uniflorous, rarely dichasial or raceme-like and many-flowered . Cotyledons fused. — Eugenia Young shoots and flowers usually glabrous. Inflorescences usually terminal (sometimes rami- or cauliflorous), usually paniculate. Cotyledons free. — Syzygium The nomenclatures of these and associated names are sometimes quite complicated and their study led to various side paths. These admittedly rambling notes may be of some interest and aid to myrtophiles. Eugenia reinwardtiana (Blume) DC. Eugenia reinwardtiana (Blume) DC., Prodr. 3: 267 (1828); Hyland, Austral. ]. Bot., Suppl. 9: 28, t. 10 (1983). — Myrtus reinwardtiana Blume, Bijdr. 17: 1082 (1826-— 1827) (*1826”). — Jossinia reinwardtiana (Blume) Blume, Mus. Bot. 1: 120 (1850) (1849); Merr., Arnold Arbor. 31: 329 (1950). — Jambosa maritima Miq., FI. Ned. Indiă 1: 435 (1855), nom. superfi. LECTOTYPE (designated here): Reinwardt s.n. - (L: sh. 898.203—352), Indonesia, Moluccas, Pulo Pombo. Eugenia rariflora Benth. in Hook., London J. Bot. 2: 221 (1843); F. Br., Bull. Bernice P. Bishop Mus. 130: 201 (1935). LECTOTYPE (designated by A.C. Smith 1985: 376): Barclay s.n., Fiji (K). Eugenia carissoides F. Muell., Fragm. 3: 130 (1863). ). LECTOTYPE (designated by Hyland 1983: Austral. J. Bot., Suppl. 9: 28): Firzalan s.n., Australia, Queensland, Port Denison (MEL 60227; iso MEL 60276). Eugenia hypospodia F. Muell., Fragm. 5: 15 (1865). LECTOTYPE (designated by Hyland 1983: 28): Dallachy s.n., Australia, Queensland, Rockingham Bay (MEL 60222). Jossinia tahitensis Nadeaud, Enum. Pl. Tahiti: 79 (1873). SYNTYPES: Not indicated (P, PC, and perhaps elsewhere, e.g., BISH /455/02: 22 Oct 1857, Tahiti, Tiari, “vallee de Haaripo et ailleurs”). Eugenia rariflora Benth. var. parvifolia Hillebr., FI. Hawai Isl.: 129 (1888) — Eugenia waianensis O.Deg., FI. Hawaii. Fam. 273, illus. (15 Jul 1932), non Eugenia parviflora DC. (1828). TYPE: Lydeate s.n., Hawaii, Oahu, northern slopes of Kaala (holo B, lost). Eugenia kangeanensis Valeton in Boerl., Icon. Bogor. 4: 107, t. 333 (“'hkangeensis ”) (1912); Merr. & L.M. Perry, Mem. Acad. Arts & Sci. 18: 140. = Mem. Gray Herb. Harvard Univ. 4: 140 (1939). LECTOTYPE (designated here): Jaheri 578, Indonesia, Moluccas, Kai Isl. (BO; film 62, neg. 1 in L). Eugenia costenoblei Merr., Philipp. ]. Sci. 9: 123 (1914) — Jossinia costenoblei (Merr.) Diels, Bot. Jahrb. Syst. 56: 531 (1921). TYPE: Costenoble 1172, Guam, Hilaan (holo US: sh. 653736, 653737). Eugenia macrohila C.T. White & W.D.Francis, Proc. Roy. Soc. Queensland 35: 69 (1923). TYPE: WD. Francis, s.n., Australia, Queensland, Marmor (holo BRI 212342; iso BRI 212343, 212344, MEL 60202). îi Eugenia nomenclatural notes 119 Jossinia desmantha Diels, ]. Arnold. Arbor. 10: 82 (1929). TYPE: Brass 887, Papua New Guinea, Central Prov., Port Moresby (holo A). Eugenia koolauensis O.Deg. var. glabra O.Deg., FI. Hawaii. Fam. 273 (10 Aug 1932). TYPE : Degener & Bush 4194, Hawai'i, Oahu, 0.5 mile SE of Pohakea Pass (holo BISH). Distribution. Malesia: Java (Kangean Isl.)., Lesser Sunda Isl. (Flores). Borneo (Sabah, Sarawak), Celebes? (fide cultivated tree in BO: A/ston 17205, Rastini 61, both în L), Moluccas (Ceram, Halmahera, Kai Isl., Pulau Pombo, Saparua), New Guinea (Aru Isl.; Central Prov., S and E of Port Moresby; curious that it is not more widespread); Pacific: Austral Isl., Fiji, Gambier Isl., Guam, Hawaii, Henderson Isl., Mariannes, Marquesas Isl., Niue, Palau, Peleliu, Pitcairn, Rapa, Rarotonga, Samoa, Society Isl., Tahiti, Tonga, Truk, Vanuatu, Yap; Australia: coastal zone of Queensland and Torres Strait 1sl., N West Australia. Habitat. On or near beaches, monsoon forests, deciduous vine thickets in Australia, 0—500 m alt.; dry forest slopes, occasionally in mesic forest, 180-730 m alt. in Hawaii; on limestone in Guam. Vernacular names. Beach cherry (Austr.), Cedar Bay Cherry (Austr.), Mountain topper (Austr.). Uses. The sweet fruit according to some has a better taste than cherries, “good bush tucker”. Used in horticulture for decoration, a minor source of fruit, and for hedges. Notes. Quite extensive discussions of this species are provided by Merrill (1950) and Hyland (1983). Merrill discussed the delimitation of the genus Jossinia Comm. ex DC. with an emphasis on J. reimwardtiana (Blume) Blume. According to Hyland, the anatomy and vascularisation of the calyx tube (hypanthium) of Eugenia reinwardtiana conforms with that of Eugenia s.s. as elucidated by Schmid (1972a, b, c). A molecular analysis of mainly S African taxa by Van der Merwe et al. (2005) placed it in a clade with species with eastern, 1.€., Asian, affinities. It was not in the clade with species formerly attributed to /ossinia Comm. Ex C: Eugenia koolauensis var. glabra ditters by being glabrous with the flowers sometimes in two approximates pairs. The type was collected from a dying tree. An anonymous reviewer of the present paper, perhaps echoing a remark by Diels (1921: 531) suggested inclusion of Eugenia palumbis Merr. Hosokawa (1940: 542) and Stone (1970: 446, 448, t. 75, 76) regarded it as distinct. Thus: Eugenia palumbis Merr., Philipp. ]. Sci. 9: 122 (1914). — Jossinia palumbis (Merr.) Diels, Bot. Jahrb. Syst. 56: 531 (1921). TYPE: Costenoble 1173, Guam, Tambun (holo US 653738). 120 Gard. Bull. Singapore 65(1) 2013 According to another, referring to Hyland (1983), E. bryanii might be a synonym of this, but Hosokawa (1940: 542) without comment, and Stone (1970: 447), tentatively kept it as distinct: Eugenia bryanii Kaneh., Botanical Magazine (Tokyo) 51: 913, f. 68 (1937). — Jossinia bryanii (Kaneh.) Hosok., ]. Jap. Bot. 16: 542. 1940. TYPE: Bryan 1229, Guam, Achugas Point (holo FU). Eugenia reinwardtiana (Blume) DC. torma /utea St. John Eugenia reinwardtiana (Blume) DC. forma /utea St. John, Phytologia 37: 441 (1977). TYPE: St. John 14901, Polynesia, Gambier Islands, Mangareva, S side of Mt Makoto (holo BISH; iso L). St. John (1977) and Smith (1985) reported the fruits as being yellow to bright orange to brownish, against red in the typical form. The latter did not mention the palatability and said that there was no reliable local Fijian name. If the fruits are as pleasant as reported elsewhere, this is remarkable and Fijian material should be studied again to see whether it really belongs here. “It certainly does not look much like the common form of E. reinwardtiana that occurs in Australia.” (Snow in litt.). Myrtus cotini folio Plumier Plumier collected in the Caribbean between 1689 and 1697. Polhill & Stearn (1976) made the following observations. Plumier made over 1200 drawings (now in the Bibliotheque Centrale, P), 508 of which were copied for Boerhaave in Leiden, the “Codex boerhaavianus” (now in the Library of the University of Groningen, The Netherlands). After Boerhaave's death these were acquired by Johan Burman in Amsterdam, who noted that Linnaeus together with Adriaan van Royen had assisted Boerhaave in his study of the “Plumerian Codex” in the winter of 1737-1738 when Linnaeus stayed at Van Royen's place. Linnaeus made notes on it in an interleaved copy of the Genera plantarum (now in LINN). Plumier used the polynomial Myrrus cotini folio in 1703, while the plate and descriptions were published by Burman in 1759. These references were not mentioned by Linnaeus (Richter 1840), possibly because he had no idea of the identity. Only as late as 1771 did he accept the Eugenia cotinifolia ot Jacquin (1768), see below. Burman's combination was invalidly published as it was a phrase name; therefore Steudel (1841) erred when he attributed “corinifolia” to him. The earliest publication where a binomial was used was that by Aublet (1775), where in the index to Latin names he cited Myrrus citrifolia for Myrtus 4 on p. 513, which is Plumier's Myrtus cotini folio. The present identity is therefore with Myrcia citrifolia (Aubl.) Urban. Because all authors have relied on Plumier's plate and their combinations thus are linked together by that, it seems the most logical choice to select it as the lectotype. In some cases specimens are mentioned and the citation of Plumier is given in an af sua De a seat Eugenia nomenclatural notes 121 attempt to match the specimen-in-hand with existing literature. Obviously, especially 18th century authors had only a faint idea of the stupendous richness's of tropical floras, and their specimens may well be something quite different from what Plumier depicted. To designate these possibly misidentified specimens (if they still exist, and, if they have been re-identified, can be found) as epitypes would make several combinations heterotypic and legitimate, and may have unforeseen destabilisation of well-accepted names. Vahl (Jul-Dec 1791) coined Myrrus coriacea, citing Swartz (1788), who is often referred to as the validating author. However, the latter had Plumier's taxon as an unnamed variety of his Myrtus acris Sw. (see for more under Pimenta acris, below) and when he did use M coriacea in 1798, he attributed it to Vahl. In the same period Gmelin (late Sep-Nov 1791) was the first to make the combination Myrrus cotinifolia. As both names by lectotypification are later homotypic synonyms of Myrtus citrifolia Aubl., it is rather unimportant to argue which had the priority over what. In the list below I have arranged them alphabetically. Poiret (1798) described a fragmentary specimen obtained by Lamarck from the garden of “citoyen” Cels and thought he could identify that with the plants described and depicted as Myrtus cotini folio Plumier (1703) or Myrtus foliis alternis ovatis Plumier (1759), and Caryophyllus aromaticus indiae occidentalis, foliis & fructu rotundis Plukenet (1696), and doubtfully with Myrzus carvophyllata Jacqg. and Myrtus acris Sw. However, as the Plumier plate is the lectotype of Myrrus cotinifolia Gmel., Poiret's use of the identical combination makes it an isonym. Steudel (1841) mentioned what he thought were three different uses of Myrzus cotinifolia: by Burman, Poiret, and Sprengel (1825). Steudel accepted that by Burman, which is an invalid name. Actually, unknown to him, Gmelin (1791) was the first to validly make this combination. The ones by Gmelin and Poiret are wholly or partly based on Plumier's plate, so the combinations by Poiret and Steudel are isonyms of that by Gmelin with no nomenclatural status. Sprengel by citing Eugenia Linnaeus (i.€., 1771: 243) referred indirectly to Eugenia cotinifolia Jacq. (1768). It is therefore a later homonym of Gmelin's name. The correct combination seems to be as follows. Myria citrifolia (Aubl.) Urb. in Fedde's Repert. 16: 150 (1919). — [Myrrus cotini folio Plum., Nov. Pl. Amer., Cat. PL.: 19 (1703), nom. nud.; Pl. Amer.: 203, t. 208, f. 2 (1759), nom. inval. (edited by J. Burman)]. — Myrzus citrifolia Aubl., Hist. Pl. Guiane 1: 513 (1775); Table des noms Latins: 20 (1775). — (Myrtus acris Sw. var. b Sw., Prodr: 79 (1788), sine comb.). — Myrrus coriacea Vahl, Symb. Bot. 2: 59 (Jul-Dec 1791); Sw.., FI. Ind. Occid. 2: 912 (1798), nom. superfi. — Myrtus cotinifolia Gmel., Syst. Nat., ed. 13, 2: 792 (late Sep-Nov 1791), nom. superfi.; Poir. in Lam., Encycel. 4: 410 (1798); Burm. ex Steud., Nomencl. Bot. ed. 2, 2: 177 (1841), isonyms. — Myrcia coriacea (Vahl) DC., Prodr. 3: 243 (1828), nom. superfi. — Pimenta citrifolia (Aubl.) Kostel., Allg. Med.-Pharm. FI. 4: 1525 (1835). — Aulomyrcia coriacea (Vahl) O. Berg, Linnaea 27: 70 (1855), nom. superfi. — Myrcia coriacea (Vahl) DC. var. swariziana Griseb., FI. Brit. W. 1.: 234 (1860). 122 Gard. Bull. Singapore 65(1) 2013 — Aulomyrcia citrifolia (Aubl.) Amshoft, Bull. Torrey Bot. Club 75: 531 (1948). LECTOTYPE (designated here): P/lumier s plate 205, fig. 2, India occidentalis, ? Jamaica. Eugenia paniculata Jacq., Coll. 2: 108, t. 5, f. 1 (Apr 1789) (1788); DC., Prodr. 3: 280 (1828), sub E. fragrans Willd. cum ? — Aulomyrcia jacquiniana O. Berg, Linnaea 27: 69 (1855), non Aulomyreia paniculata O. Berg (1855: 49). — Myrcia coriacea (Sw.) DC. var. jacquiniana (O. Berg) Griseb., FI. Brit. W. L.: 234 (1860). — Myrcia paniculata (Jacq.) Krug & Urb. in Urb., Bot. Jahrb. Syst. 19: 577 (1895) (“panniculata”). TYPE: Aquart in Herb. Jacquin, s.n., Martinique (holo W). Caryophyllus cotinifolius Miller Miller (16 Apr 1768) was the first to validate Caryvophyllus cotinifolius, which in previous editions of the Dictionary he had called Caryophyllus foliis ovatis obtusis oppositis, floribus sparsis alatibus and noted that this would be the same as “Myrrus cotini folio. Plum. Cat. 19” of 1703. | His material had been collected between 1734-1740 by the surgeon Robert Millar in Cartagena of New Spain (now Colombia). There is no evidence that either Millar or Miller sent a duplicate to Linnaeus or anybody else. The name is not mentioned by Sweet (1826) which suggests that the species was not in cultivation in England anymore. From Miller's description and remarks it is obvious that that he was descnibing living plants which he probably had grown in his garden in Chelsea, and tried to identify these with existing lterature, e.g., Plumier's plate. Remarkably, Scott (1980: 475) while stating that he had seen the holotype of Eugenia cotinifolia Jacqg. in BM, noted that “it was collected or communicated by D. Miller in 1763”. This is against the fact that Jacquin did not mention any collector, but said that he had seen the specimen in Gronovius's herbarium with unknown provenance! | think that there has been a mix-up with Philip Miller's Caryophyllus cotinifolius. Note that “D.” is not an initial, but stands for “Dominus”. Mr. Govaerts et al. (2008: 62) have equated this with Eugenia cotinifolia Jacq., see below. Carvophyllus cotinifolius Miller, The Gardeners Dictionary, ed. 8: Carvophyllus 4 (16 Apr 1768). TYPE: Millar s.n. A” 1736, possibly cultivated in Chelsea from seed from Colombia, Cartagena (holo BM). Eugenia cotinifolia Jacqg. Independently, Jacquin (1768, precise date unknown, presumably later than Miller) described and depicted (fruits only) an Eugenia cotinifolia based on a specimen he had seen (or received?) from Gronovius without an indication of its origin. He compared it with E. carthagenensis Jacq. and E. uniflora, which he noted to have seen in Martinique, where the natives called it “Cerisier de Cayenne”, or Cayenne a Ss, n dm Eugenia nomenclatural notes 123 cherry. This was evidently misread by Linnaeus (1771) who gave as the provenance of Jacquin's species “Cayenne” (French Guyana), the start of a lengthy confusion and misapplication of its name. Sprengel (1825) for some reason added the Mascarenes to its distribution. Johan Frederik (Jan Fredrik) Gronovius (1686-1762) was the patron, host, and friend of Linnaeus during his stay in Leiden, Rapenburg 52, with the Hortus botanicus on the other side of the canal and his printers on the corner at no. 56, now the well- know pub Barrera. Linnaeus surely saw his herbarium, obtained material from it, and also (falsely) attributed the name Linnaea to him. There is an unwritten (?) convention that you cannot name taxa after yourself (or your ancestors). In Linnaeus's herbarium is a specimen (637.177; as usual without provenance) misidentified (Merrill 1950: 332) as Myrtus pimenta L. with a pencilled note by J.E. Smith referring to the Jacquin specimen in the Banks herbarium, BM. However, Savage (1945) reported the presence of a list of specimens sent by Jacquin to Linnaeus in the Linnaean Correspondence and this one was not in it. In short, its provenance is unknown, and that it may have come from Gronovius, Jacquin, or even Miller is pure speculation. 1 therefore think that McVaugh (1968) erred when he suspected that all three references were based on the same source. However, he had found no match for it among the taxa that he knew from the West Indies or northern South America. Jacquin's herbarium was bought by Banks and is presently in BM. However, his West Indian collections are rare and fragmentary (Dandy 1979). MeVaugh (1968) couldn't find anything, but Scott (1980: 475) did. He noted that it was not identifiable anymore, as flowers (Jacquin didn't have any) and fruits have been lost. In any case, it was not like any species from the Mascarenes, Africa, Madagascar, Malesia, or Australia that he had seen. De Candolle (1828) made the combination /ossinia cotinifolia and (mis)applied it to material that had come from the mountains of Bourbon (now Reunion) in the Mascareignes. He cited Sprengel with a question mark, adding “excel. patr.”, which 1 read as “excluding provenance (patria)”, apparently referring to Cayenne. Because of the influence of the Prodromus this was perpetuated by later authors for various species there (e.g. Baker 1877, with 5 varieties!) and its distribution was gradually extended to Sri Lanka, S India, and Polynesia. This is the interpretation of the epithet that Hyland was referring to. Actually, Blume (1850: 123) had already seen the error, but as he retained J. cotinifolia DC. for the Mascareignes, excluding the references to Jacquin and Sprengel, he actually created a new species with a later homonym, /Jossinia cotinifolia DC. ex Blume, non Jacq., typified by Commerson 516 (holo L; iso K, P). This is a synonym of E. orbiculata Lam. (Scott 1980: 480). Urban (1920) restricted Miller's name to Plumier's Caribbean element, which he identified with Myrcia citrifolia (Aubl.) Urban. This splitting-up is obviously erroneous, as Miller described material from Colombia, and only attempted to match it with existing, literature. Moreover, in lectotypification material has priority over illustrations. 124 Gard. Bull. Singapore 65(1) 2013 It therefore cannot be ruled out that Miller's and Jacquin's species, only known from a few 18th century collections, is now extinct. For some reason, Govaerts et al. (2008: 139) give Venezuela as the distribution. Eugenia cotinifolia Jacq., Obs. Bot. 3: 3, t. 53 (1768); L., Mant. Alt.: 243 (1771) (“Cayenne”). —Myrtus cotinifolia (Jacq.) Spreng., Syst. Veg. 2: 481 (1825) (“Cayenn. Mascaren.”), non Poir. (1798). — Jossinia cotinifolia (Jacq.) DC., Syst. Veg. 3: 238 (1828). TYPE: Herb. Jacquin s.n. ex herb. Gronovius, provenance unknown (holo BM; ? LINN). Jossinia Comm. ex DC. The ING at the moment of writing (in a version of 9 Feb 1996) stated that a type had not been designated. However, Scott (1980) chose /Jossinia finifolia (Lam.) DC. before Ashton (1981: 408) selected /ossinia cotinifolia (Jacq.) DC. Jossinia Comm. ex DC., Prodr. 3: 237 (337) (1828). LECTOTYPE: Jossinia tinifolia (Lam.) DC. Other names The following names are not in an alphabetical order as one is linked to the other. Eugenia elliptica Lam. This was described from Mauritius and reduced to one of the 5 varieties of Eugenia cotinifolia by Baker (1877). Ashton (1981) regarded it as a synonym of the “typical subspecies”, and added two more for Sri Lanka: Eugenia cotinifolia Jacqg. subsp. codyensis (Munro ex Wight) P.S.Ashton from Sri Lanka and the Western Ghats, India, and subsp. phillyreoides (Trimen) P.S.Ashton, a Sri Lanka endemice only known from the type. Kostermans (1981: 164) disagreed with this and for what had been called Eugenia cotinifolia and Eugenia elliptica in Sri Lanka he proposed the new species Eugenia hypoleuca. Blume (1850) made the new name Jossinia lamarckii tor Eugenia elliptica Lam. and Myrtus elliptica Spreng., because he considered E. e/liptica Lam. and M. elliptica Spreng as different from J. e/liptica DC, but the latter was based on that of Lamarck and /ossinia lamarckii Blame is therefore a superfluous name. Scott (1990: 12) has all “e//ipticae” under E. eliptica, and (p. 16) Jossinia lamarekii erroneous!y under £. lucida Lam., as if it was an independent species with Commerson 512 (L, “holo”) as the type. Eugenia elliptica Lam., Encycl. Meth. 3: 206 (1789). — Myrtus elliptica (Lam.) Spreng., Syst. Veg. 2: 483 (1825). — Jossinia elliptica (Lam.) DC., Prodr. 3: 237 (1828). Eugenia nomenclatural notes 125 — Jossinia lamarckii Blume, Mus. Bot. 1: 121 (1850) (“1849”), nom. superfl. — Eugenia cotinifolia Jacq. var. elliptica (Lam.) Lam. ex Baker, FI. Mauritius: 114 (1877). TYPE: Commerson s.n., Mauritius (holo P-LA; iso P, P-JU 73923). Govaerts et al. (2008: 142) added to this: Jossinia cordifolia Bojer, Hort. Maurit: 141 (1837), nom. nud. — Fugenia cotinifolia Jacq. var. cordifolia Bojer ex Baker, FI. Maurit. Seych.: 114 (1877). TYPE: Bojer s.n., Mauritius (K). Eugenia hypoleuca Thwaites ex Kosterm. This name needed to be included here, as Kostermans (1981: 164) compared it to Eugenia codyensis Munro ex Wight and E phillyreoides Trimen. Eugenia hypoleuca Thwaites ex Beddome, For. Man.: 112 (1872), nom. nud.; Kosterm., Quart. J]. Taiwan Mus. 34 (3-4): 164 (1981). TYPE: Kostermans 28088 (holo L, iso PDA). Eugenia codyensis Munro ex Wight Eugenia codyensis Munro ex Wight, III. Ind. Bot. 2: 13 (1841) — Eugenia cotinifolia Jacq. subsp. codyensis (Munro ex Wight) P.S.Ashton in Dassan., Rev. Handb. FI. Ceylon 2: 412 (1981). — Syzygium codvense (Munro ex Wight) Chandrab., Biol. Mem. 2: 57 (1977). TYPE: Wight s.n., India, Karnataka, Coorg (Kodagu) near Mercara (Madikeri) (12 25” N, 75" 45'E)(holoK). Notes. Named after the village Kody or Cody near Vittal close to Sampage Ghat. This locality is also mentioned for Ophiorrhiza codyensis Gamble (1919). Kostermans (1981: 165) said that from the description this is a species distinct from E. hypoleuca, but Govaerts et al. (2008: 185) equated the two. Eugenia phillyreoides Trimen Eugenia phillvreoides Trimen, J]. Bot. 23: 207 (Jul 1885); Syst. Cat. Ceylon: 33 (Jun / Jul 1885) (nom. nud., “phil/lvraeoides”); Handb. FI. Ceylon 2: 183 (1894); Kosterm., Quart. J]. Taiwan Mus. 34(3-4): 164 (Dec 1981). — Syzygium phillyreoides (Trimen) Santapau, Kew Bull. (3): 276 (1948). — Eugenia cotinifolia Jacqg. subsp. phillvreoides (Trimen) P.S.Ashton in Dassan., Rev. Handb. FI. Ceylon 2: 413 (1981) (“phyllyraeoides”). TYPE: Anon. s.n., May 1584, Sri Lanka, summit of Kalupahane Kande (holo K; iso L, PDA). Eugenia mooniana Wight, Il. Ind. Bot. 2: 13 (1841); Icon. PI. Ind. Orient. 2: 4,t. 551 (1840-1843), non Gardn. (1841). SYNTYPES: Moon s.n., Sri Lanka (? BM), Wight s.n., India, Courtallum (?kK.). 126 Gard. Bull. Singapore 63(1) 2013 Notes. Kostermans (1981: 165) said that this is a species entirely different from £. hypoleuca, and more similar to E. mandugodaense Kosterm. and E. willdenowii DC. There have been some alternative orthographies of the epithet. The original one 15 “phillvreoides”, but “phillyraeoides” and “phyllyraeoides” in later publications. As it is derived from Phillyrea L. (Oleaceae) the correct orthography seems to be “phillyreoides” [Rec. 60G.1(1) and (2)]. Eugenia bukobensis Engler The combination Eugenia bukobensis Engler (1899) is for a species widespread in Kenya, Tanzania, and Uganda. Engler had previously (1895) misidentified it with Eugenia cotinifolia Jacqg. var. elliptica (Lam.) Lam. ex Baker. That it was a misidentification 1s not immediately clear, but can be deduced from the facts that Engler called it a “n. sp.” (new species) and cited Baker's combination name as “ex Engl.”, which we now would write as “sensu Engl.”, or “auct. non Baker: Engl.”. | However, Fosberg (1978) and Verdcourt (1999, 2001) regarded the citation as a reason to declare the name superfluous and it was proposed for conservation (Verdcourt et al. 2002). This proposal was rejected as unnecessary for the reasons given above (Brummitt 2004). Eugenia bukobensis Engler, Notizbl. Bot. Gard. Berlin 2: 289 (1899). — Syntypes: Stuhlmann 3261, 3749, 3756, 3794, 3881, “Centralafrikanisches Seengebiet”, now Tanzania, Bukoba (B, lost). NEOTYPE (designated by Verdcourt et al. 2002): Gillman 260 (K.). Eugenia cotinifolia Jacg. var. elliptica auct. non (Lam.) Baker: Engl., Pflanzenw. Ost- Afrikas C: 287 (1895). Myrtus pimenta L. This is a totally different subject, brought about by Mrzus cyrrifolia Poir. (1798), non M. citrifolia Aubl. (1775) and the confusion created by the application of Myraus cotini folia Plum. by Landrum (1986: 106-107). Linnaeus (1737: 501) mentioned Myrrus calvcibus absque appendiculis based on Myrtus arborea aromatică, foliis laurinis Sloan., flor. 161 [i.e. Cat. PL. Jamaica, 1696]. hist. 2.p.76,t. 191. f£..1 [i.e., Voy. Jamaica, 1725], and Caryophyllus aromaticus americanus, lauri acuminatis foliis, fructu orbiculari. Pluk. alm. 88, t. 155. f.4 [1692], both from Jamaica. He noted that the generic position needed further scrutiny by those who could study living plants. In his Flora zeylanica (1748) for some reason he mentioned this species again (as Myrtus foliis alternis, but did not actually say that it occurred in Ceylon = Sri Lanka), while in the Materia medica (17409 sub no. 225) he cited the FI. Zeyl. with a question mark. The remark “Zeylon?, Cuba, Guiana” cited by Landrum (1986: 106) is made under the next species, Myrrus foliis obverse ovatis FI. Zeyl. 183?, which is Pimenta racemosa. This made later authors believe that he described the species from Sri Lanka (e.g. Landrum 1986: 106). The confusion was Eugenia nomenclatural notes 127 increased when in 1753 for Myrtus pimenta he stated “Habitat in India” and gave references to both the Flora zeylanica and the Jamaica ones. This is another example that he was not always too clear in his distinction between the East and West Indies. Thus Poiret (1798) was misled to think that there were American and Ceylonese species involved and he apparently thought that the East Indian one was the major part and so proposed Myrtus cytrifolia tor the American one. This is an orthographic variant of M. citrifolia Aubl. (1775) and also is a superfluous name for Myrtus pimenta. It 1s interesting to note that Heyne (1950: 1181, sub Pimenta officinalis Lindl.) remarked that cultivation outside Jamaica has always been unsuccessful, and the plants only exceptionally flowered. It was introduced in Sri Lanka in 1824. According to Landrum (1986, with an extensive synonymy) the correct name is Pimenta dioica (L.) Merr., and he appointed as the lectotype Sloane, History of Jamaica 2: t. 191, £. 1. 1725. There is no mention of the possible presence of a specimen in the Sloane Herbarium (BM) that may have served as the basis of the plate (“typotype”) and would be a good candidate for an epitype. Myrtus caryophyllata L. The German physician, Paul Hermann, prepared a number of herbania in book form during his stay in Ceylon (Sri Lanka) between 1672 and 1677. One of these, now in the Institute de France, Paris, was used by Burman (1737). Lourteig (1966) gave an enumeration of the contents of its single volume. The largest and most important copy, consisting of 5 volumes, is that now in BM which was seen by Linnaceus (1748). A third copy in two volumes is in L which, contrary to Van Ooststroom (1937), was not seen by Linnaeus. It therefore contains no direct Linnaean elements although many specimens may be syntypes under Art. 9 Note 2(c). A fourth 1-volume copy 1s in the Forschungsbibliothek, Gotha, Germany, extensively discussed by Rauschert (1970). Linnaeus (1748) described Myrrus foliis obverse ovatis with a fairly detailed description and the following references: Cerasus humilis umbellata, flosculis incarnatis, fructu Montinghos dicto. Burm. zeyl. SIA Caryophyllus aromaticus indiae occidentalis, foliis & fructu rotundis, dipyrene, seminus fere orbiculatis planis. Pluk. alm. 88, t. 15.f.3 (an?) Danighas Herm. zeyl. 3. Dam, Herm. zeyl. 14, 53. Rightly, he was not sure about the Plukenet reference, as this refers to a West (!) Indian collection, which, as we now know, possibly represents Pimenta racemosa (MIll.) ].W.Moore (Landrum 1986: 106), but Linnaeus's ideas about India were rather hazy (as noted above, his “India” can refer to both the West and East Indies!) and so he confused himself and later authors. For his descriptions he used the BM Hermann herbarium in which there are six fragments. All have been regarded as original elements by Jarvis (2007) and the lectotypification is attributed to Kostermans (1981: 133). However, the latter merely stated “Herb. Hermann (BM)”. BM 0006211251 on vol. 1, fol. 7 is designated here as 128 Gard. Bull. Singapore 65(1) 2013 the lectotype. BM 000621253 would be an isolectotype. The other parts in the other volumes were most likely collected at a later moment, and so are syntypes. The L Hermann collection (Van Ooststroom, 1937: fol. 22), although not seen by Linnaeus, | would call a syntype [Art. 9, Note 2(c)]. Lourteig (1966) did not mention any specimen in the Paris copy, and Rauschert (1970) none in that at Gotha. In 1749, Linnaeus apparently had changed his mind and accepted the reference to Plukenet and the origin as Cuba and Guiana (!), while the reference to the Flora zeylanica and Zeylona were given a question mark. In 1753 he reversed again, now giving the references to the Flora zeylanica and Plukenet equal status, but with “Zeylona” as the only provenance. His reference to the Materia medica should read “226”, not 225”, which latter number is correctly cited under the next species, Myrrus pimenta. Obviously, the Plukenet citation should be discarded as being an attempt to identify material-in-hand with existing literature. This was also realised by Swartz (1788, 1798), see below under Pimenta acris (Sw.) Kostel. Although Trimen identified the Hermann specimens, he (1894: 174) probably because of the Kew Rule (first epithet used under a particular generic name) called the Sri Lanka species Eugenia corymbosa Lam. (1789) with Myrrus carvophyllata L. (1753) and Syzygium carvophyllaeum Gaertn. (1788) in synonymy. Eugenia corymbosa Lam. (1789: 199) is based on Vara Rheede, Hort Malab. 5: 53, t. 27 (1685) and a Sonnerat collection from India. The latter would seem the obvious type. Ashton (1981: 451) cited it as Syzygium corvmbosum (Lam.) DC, which is an error for “(Blume) DC.”, based on Ca/yprranthus corymbosus Blume (1824: 291) from Java. De Candolle (1828: 261) transferred the latter to Syzygium corvmbosa (Blume) DC. while he retained (1828: 284) Eugenia corymbosa Lam. in Eugenia. The occurrence of this species in Borneo as is mentioned in the older literature is erroneous, and probably refers to Syzygium lineatum (DC.) Merr. & L.M.Perry (1939: 172). The correct name is Syzygium carvophyllatum (L.) Alston in Trimen, Hand- Book FI. Ceylon 6, Suppl.: 116 (1931). Myrtus caryophyllus Spreng. Myrtus carvophyllus Spreng.. Syst. Veg. 2: 485 (“483”) (1825) is a superfluous name for Carvophyllus aromaticus L. from the Moluccas. He also cited Eugenia carvophyllata Thunb., Willdenow. Syzygium caryophyllaeum Gaertn. Syzygium caryophyllaeum Gaertn. is the conserved type ot Syzygium Gaertn. designated by MceVaugh (1956). It was described on material then in L from Ceylon (De Candolle 1828: 260, said “herb. Van-Royen”). This appears to have been lost. — Eugenia carvophyllaeum (Gaertn.) Wight, IIl. Ind. Bot. 2: 15 (1841); Icon. Pl. Ind. Eugenia nomenclatural notes 129 Orient. 2: 3, t. “540 / 1017” (1840-1843). EPITYPE (designated here): Kostermans 24707 (L! iso K! PDA, US). Pimenta acris (Sw.) Kostel. Pimenta acris (Sw.) Kostel. was indirectly based on Myrtus acris Sw. (1788: 79; 1798: 909), which is generally considered as a superfluous name for Myrtus carvophyllata L. This is incorrect, for Swartz referred to Caryophyllus aromaticus indiae occidentalis, foliis et fructu rotundis, dipyrene, seminibus fere orbiculatis planis Pluk. (Alm. 188, t. 155, f. 3. 1692) and Myrtus caryophyllata sensu Jacqg. (1767) from the Caribbean, which he regarded as different from Linnaeus's East Indian M. carvophyllata L. as he explained more fully in 1798 (p. 910). In this he was followed by Kosteletzky (1835). This idea, however, was caused by the false impression that Linnaeus (1753) made when he gave the provenance of his Myrtus carvophyllata as “Zeylona”, while including also a South American reference. The Plukenet reference may represent Pimenta racemosa (Mill.) J.W. Moore (Landrum 1986: 106). The name therefore originally was legitimate, but in 1798 Swartz also cited Caryophyllus racemosus “Mill. Dict.”, which refers to the Gard. Dict. Ed. 8, Caryophyllus no. 5. 1768, which epithet under the present rules he should have adopted, and it becomes a synonym. According to Landrum (1986: 108) this is now Pimenta racemosa (Mill.) ].W. Moore var. racemosa. Pimenta acris (Sw.) Kostel. var. citrifolia Kostel. was mentioned by Ashton (1981: 403) as introduced in Sri Lanka. | have not found this combination made anywhere, and it is not in Govaerts et al. (2008: 342). Eugenia roxburghii DC. Eugenia roxburghii DC., Prodr. 3: 271, £ 74 (1828). — Eugenia zeylanica auct. non Willd.: Roxb., Hort. Beng.: 92 (1814) (“zeylonica”), nom. nud.; FI. Ind. 2: 490 (1832); Ashton in Dassan., Rev. Handb. FI. Ceylon 2: 416 (1981) (“ceylanica”). — Eugenia bracteata (Willd.) Raeusch. ex DC. var. roxburghii (DC.) Duthie in Hook.f., FI. Brit. India 2: 502 (1879). TYPE: Roxburgh in Herb. Lambert in Herb. DC. (holo G; microfiche IDC), see also Wa/lich 3621-A (K:; IDC microfiche 7394) and Roxburgh s.n., Icon Ined. 2502 (CAL, K), Bangladesh, Sylhet. Myrtus bracteata Willd., Sp. PL., ed. 4, 2, 2: 969 (1799). — Eugenia ? bracteata (Willd.) Roxb., Hort. Beng.: 37 (1814), nom. inval.; Raeusch. ex DC., Prodr. 3: 264. 1828; Roxb., FI. Ind., ed. 2, 2: 490 (1832), isonym, non Rich. (1792). — Syzygium bracteatum (Willd.) Racusch (“Roxb.”) ex Korth., Ned. Kruidk. Arch. 1: 205 (1846); Raizada, Indian For. 74: 336 (1948) (n.v.), isonym. TYPE: Klein 4” 1796 in Herb. Willdenow 9553 (holo B; microfiche IDC 7440), “India orientali”, probably Tamil Nadu, Tranquebar (= Tharangambadi). Myrtus ruscifolia Willd., Sp. PI., ed. 4, 2, 2: 970 (1799), non Eugenia ruscifolia Poir. (1813). — Syzygium ruscifolium ( Willd.) Santapau & Wagh, Bull. Bot. Surv. India S: 130 Gard. Bull. Singapore 65(1) 2013 109 (1964), nom. superfl. [Duthie in Hook.f., 1879: 502, already had synonymised M. ruscifolia with M. bracteata, therefore, under Art. 11.5 Santapau & Wagh should have adopted S. bracteatum (Willd.) Raeusch ex Korth.]. LECTOTYPE (designated here): Roxbureh in Herb. Willd. 9557, India orientali, probably Tamil Nadu, Trangquebar (= Tharangambadi) (B; IDC microfiche 7440: third sheet on right in microfiche; the other two are from Rottler through Klein, collected Sep 11, Oct 3, 1799, so too late to have been with Willdenow in Dec 1799). Myrtus latifolia B. Heyne ex Roth, Nov. Pl. Sp.: 232 (1821); Panigrahi, ]. Econ. Taxon. Bot. 5: 993 (1984), non Eugenia latifolia Aubl. (1775). — Myrtus heynei Spreng., Syst. Veg. 2: 482 (1825), nom. superfi. — Fugenia heynei Rathakr. & N.C. Nair, J. Econ. Taxon. Bot. 5: 232 (1984), nom. superfi. | Eugenia bracteata (Willd.) Roxb. cited]. — Eugenia rothii Panigrahi, ]. Econ. Taxon. Bot. 5: 994 (1984), nom. superfl. (Eugenia bracteata cited). TYPE: Heyne in Herb. Roth, India, probably Tamil Nadu, Tranquebar (= Tharangambadi) (holo B, probably lost). Eugenia fasciculata Wall. ex Blume, Mus. Bot. 1: 87 (1850) (1849). — Eugenia bracteata (Willd.) Raeusch. ex DC. (“Roxb.”) var. fasciculata (Wall. ex Blume) Duthie in Hook.f., FI. Brit. India 2: 502 (1879). — Eugenia rothii Panigrahi var. fasciculata (Willd. ex Blume) H.B. Naithani, FI. PI. India, Nepal & Bhutan: 165 - (1990). LECTOTYPE (designated here): Wa/lich 3622, India, Mont. Pundora (?), 1824 (L: sh. no. 898.203 55; iso L, sh. no. 898.203-—54; K: IDC microfiche 7396). Myrtus quadripartita Royen ex Blume, Mus. Bot. 1: 87 (1850) (*1849”; nom. nud., in synon. sub E. bracteata) — Vouchers: Kotella (Herb. A. van Royen s.n., Sri Lanka, L sh. no. 898.203— 50, — 52,—53). Eugenia macrosepala Duthie in Hook.f., FI. Brit. India 2: 501 (1879). TYPE: Srocks s.n., India, N. Canara (holo K). Distribution. Bangladesh (Sylhet), India (Meghalaya, S$ India, Madras, Namailay Mts), Sri Lanka, Myanmar (Irrawaddy, Tenasserim), Thailand (Northern: Phitsanulok, Uttaradit; Northeast: Sakon Nakhon; East: Chaiyaphum; Southeast: Chanthaburi), S Vietnam (Nhatrang; Thuduc; Poulo Condor, now Conson). Notes. Govaerts et al. (2008: 163) regarded this as a “true” Eugenia. The specimens cited under Syzygium bracteatum (Willd.) Raeusch (“Roxb.) ex Korth., Ned. Kruidk. Arc. 1: 205. 1846, belong to Syzygium zeylanicum (L.) DC. (Mr. Wuu Kuang Soh, or. comm.). Calyptranthes ramiflora Blanco Govaerts et al. (2008: 416) included as a synonym Syzygium latifolium Blanco (1845) and regarded it as a nom. illeg. (non DC.). Actually it is a misidentification by Blanco of what he had described earlier (1837) as Ca/yprranthes ramiflora. Calyptranthes ramiflora Blanco, FI. Filip.: 420 (1837). — Syzygium latifolium auct. non DC.: Blanco, FI. Filip., ed. 2: 294 (1845). NEOTYPE (designated here): Eugenia nomenclatural notes 131 Merrill Sp. Blancoan. 669 (Ramos), Philippines, Luzon, Bulacan Prov.. Sapang Santel, December 18. 1914 [holo US. 00904347, Barcode No.: 00689164; iso A, B, BM, BO, CAL, F, GH, K, L, MO, NSW, NY, P,U (in L), UC, W]. See http://botany.si.edu/colls/blanco/blancoimages/Blanco_640/00689164.jpg = Eugenia similis Merr. = Syzygium simile (Merr.) Merr. (Robinson 1909: 386, 403; followed by Merrill 1918). Eugenia salomonica C.I.W hite Eugenia salomonica C.T. White, ]. Arnold Arbor. 32: 141 (1951). TYPE: Kajewski 1574, Solomon Isl., Bougainville, Kieta, March 1930 (holo A). Distribution. Papua New Guinea (St. Matthias Group: Mussau Isl.; Bougainville), Vanuatu (former Solomon Isl.: Santa Cruz Isl.: T&motu Noi (Nendâ); Santa Isabel). ACKNOWLEDGEMENTS. Mr. L.A. Craven (CANB), Dr. N. Snow (BISH), Dr. P.G. Wilson (NSW), Mr. P. Widodo (Institut Pertanian Bogor), and two unknown reviewers are much thanked for various comments. Craven provided localities of Eugenia reimwardtiana in PNG. Dr. H.-]. Esser kindly checked the holdings in M for some specimens. References Ashton, P.S. (1981) Myrtaceae. In: Dassanayake, M.D. A Revised Handbook to the Flora of Ceylon 2: 408, 412, 450-451. New Delhi: Amerind Publishing Co.; Rotterdam: A.A. Balkema. Aublet, J.B.C.F. (1775) Histoire des plantes de la Guiane francoise |: 513; Table des noms Latins: 20. London: Aublet; Paris: Didot f. Baker, J.G. (1877) Flora of Mauritius and the Seychelles: 114. London: Reeve & Co. Blume, C.L. (1824) Ueber die vegetation des Berges Gedee auf der Insel Java. Flora 7: 291. Blume, C.L. (1850) (1849). Ord. Myrtaceae. Subord. Myrteae. Museum Botanicum Lugduno- Batavum |: 119-124. Brummitt, R.K. (2004) Report of the Committee for Spermatophyta: 54. axon 52: 822. Burman, ]. (1737) Thesaurus Zeylanicus: 57. Amsterdam: Jansson-Waesberg & Schouten. Dandy, J.E. (1979) In: Stafleu, F.A. & Cowan, R.S. Taxonomic Literature ed. 2, 2. Regnum Veg. 98: 407. De Candolle, A.P. (1828) Myrtaceae. In: Prodromus Systematis Naturalis Regni Vegetabilis 3: 238. Paris: Treutel & Wiirz. Diels, L. (1921) Die myrtaceae Mikronesiens. Bor. Jahrb. Syst. 56: 531. Engler, A. (1895) Die Pflanzemwelt Ost-Afrikas und der Nachbargebiete C: 287. Berlin: Reimer. Engler, A. (1899) Diagnosen neuer Afrikanischer Pflanzenarten. 3. Myrtaceae. Notizbl. Kânigl. Bot. Gart. Berlin 2: 289. Fosberg, F.R. (1978) Miscellaneous notes on the flora of Aldabra and neighbouring islands. VII. Eugenia elliptica var. levinervis (Myrtaceae). Kew Bull. 33: 133—134. 132 Gard. Bull. Singapore 65(1) 2013 Gaertner, ]. (1788) De fructibus et Seminibus Plantarum: 166, t. 33, f. 1. Stuttgard: Gaertner. Gamble, ].S. (1919) Decades kewenses. Bu//. Misc. Inform. Kew 1919: 406. Gmelin, J.F. (1791) Systema Naturae ed. 13, 2: 792. Leipzig: Beer. Govaerts, R. et 12 al. (2008) Wor/d Checklist of Myrtaceae: xv, 455. U.K.: Royal Botanic Gardens, kew. (See also http://apps.kew.org/wesp/myrtaceae) Heyne, K. (1950) De Nurige Planten van Indonesie |: 1181. Bandung: Van Hoeve, “S-Gravenhage. Hosokawa, T. (1940) Materials of the botanical research towards the flora of Micronesia (XIX). J. Jap. Bot. 16: 54. Hyland, B.P.M. (1983) A revision of Syzygium and allied genera (Myrtaceae) in Australia. Austral. J. Bot., Suppl. Ser. 9: 31. Ingle, H.D. & Dadswell, H.E. (1953) The anatomy ofthe timbers of the south-west Pacific area. Austral. J. Bot. L: 353-401. Jacquin, N.J. (1767) Observationes Botanicarum 2: |. Vienna: Kraus. Jacquin, N.J. (1768) Observationes Botanicarum 3: 3, t. 53. Vienna: Kraus. Jarvis, C. (2007) Order Out of Chaos: 687. London: Linnean Society. Kosteletzky, V.F. (1835) A/lgemeine Medizinisch-Pharmazeutische Flora 4: 1526. Prague: Borrosch & Andre. Kostermans, A.J.G.H. (1981) Eugenia, Syzygium and Cleistocalyx (Myrtaceae) in Ceylon: A monographical revision. Quart. J. Taiwan Mus. 34(3-4): 132-133, 164-165. Lamarck, J.B.P.A. de Monet de (1789) Encyclopedie Methodique 3: 199, 206. Paris: Panckoecke; Liege: Plomteux. Landrum, L.R. (1986) Campomanesia, Pimenta, Blepharocalyx, Legrandia, Acea, Myrrhinum, and Luma (Myrtaceae). FI. Neotrop. 45: 83-84, 105-107. Linnaeus, C. (1737) Hortus Cliffortianus: 501. Amsterdam: Clifford. Linnaeus, C. (1748) Flora Zeylanica: 83. Amsterdam: Wetstenium. Linnaeus, C. (1749) Materia Medica: 78. Stockholm: Salvius. Linnaeus, C. (1753) Species Plantarum: 472. Stockholm: Salvius. Linnaeus, C. (1771) Mantissa Altera: 243. Stockholm: Salvius. Lourteig, A. (1966) L'herbier de Paul Hermann, base du Thesaurus zeylanicus de Johan Burman. Zaxon 15: 23-33. Lucas, E.J., Belsham, S.R., Nic Lughadha, E.M., Orlovich, D.A., Sakuragui, C.M., Chase, M.W. & Wilson, P.G. (2005) Phylogenetic patterns in the fleshy-fruited Myrtaceae — preliminary molecular evidence. P/. Syst. Evol. 251: 35-51. MeVaugh, R. (1956) Nomenclatural notes on Myrtaceae and related families. Zaxon 5: 164 165. MeVaugh, R. (1968) Myrtaceae, in B. Maguire et al., The Botany of the Guyana Highland-Part VIII. Mem. New York Bot. Gard. 18(2): 217-218. Merrill, E.D. (1918) Species Blancoanae. Publ. Bur. Sci. Gov. Lab. 12: 289. Merrill, E.D. (1950) The synonymy of. Jossinia reinwardtiana (Blume) Blume. J. Arnold Arbor: 31: 329-333. Merrill, E.D. & Perry, L.M. (1939) The myrtaceous genus Syzygium Gaertner in Borneo. Mem. Amer. Acad. Arts 18. = Mem. Gray Herb. 4: 140, 172. Miller, P. (1768) The Gardeners Dictionary ed. 8: 4, 5 (Carvophyllus). London: Miller. Pike, K.M. (1956) Pollen morphology of Myrtaceae from the south-west Pacific area. Ausiral. J. Bot. 4: 13-53. Plukenet, L. (1696) 4/magestum Botanicum: 88. London: Plukenet. Plumier, C. (1703) Nova Plantarum Americanum Genera: 19. Paris: Bondot. Eugenia nomenclatural notes 133 Plumier, C. (1759) Plantarum Americanum: 203, t. 208, f. 2. Leiden: Burman;Amsterdam. Poiret, ].L.M. (1798) In: Lamarck, J.B.A.P. de Monet de, Encyclopedie Merhodique, Botanique 4: 410. Paris: Agasse. Polhill, R.M. & Stearn, W.T. (1976) Linnaeus's notes on Plumier drawings with special reference to Mimosa latisiliqua. Taxon 25: 323-325. Rauschert, S. (1970) Das Herbarium von Paul Hermann (1646-1695) in der Forschungbibliothek Gotha. FHercynia N.E 7: 301-328. Rheede tot Draakestein, H.A. van (1685) Hortus Indicus Malabaricus 5: 53, t. 27. Amsterdam: Van Someren & Van Dyk. Richter, H.E. (1840) Codex Botanicus Linnaeanus. Pp. 1102 + 202. Leipzig: Wigand. Robinson, C.B. (1909) A preliminary revision of Philippine Myrtaceae. Philipp. J. Sci. 4: 386, 403. Savage, S. (1945) A Catalogue of the Linnaean Herbarium: Pull-out Leaf at the Back. London: Taylor & Francis. Schmid, R. (1972a) A resolution of the Fugenia-Syzygium controversy (Myrtaceae). Amer. J. Bot. 59: 423-436. Schmid, R. (1972b) Floral anatomy of Myrtaceae. 1. Syzygium. Bot. Jahrb. Syst. 92: 435-489. Schmid, R. (1972c) Floral anatomy of Myrtaceae. II. Eugenia. J. Arnold Arbor. 53: 336-363. Scott, A.J. (1980) Notes on Myrtaceae in the Mascarenes with some recombinations for taxa from Aldabra, Malaya, New Caledonia. Kew Bull. 34: 473-475, 477, 480, 496. Scott, A.J. (1990) Myrtaceae. In: Flore des Mascareignes 92: 12, t. 2, f. 5, 6. Mauritius: Sugar Industry Research Institute; Paris: ORSTOM; U.K.: Royal Botanic Gardens, Kew. Smith, A.C. (1985) Myrtaceae. In: Flora Vitiensis Nova 3: 374, 376. Lawai, Hawaii: Pacific Tropical Botanical Garden.. Snow, N. & Wilson, P.G. (2010) New species of Eugenia and Gossia (Myrtaceae: Myrteae) from Papua New Guinea. 7elopea 12: 454-457, t. 1, 2. (See Telopea 13: 359 (2011) for emendation of type.) Sprengel, K. (1825) Systema Vegetabilium ed. 16(2): 481. Gottingen: Dieterich. St. John, H. (1977) Notes on Eugenia (Myrtaceae) and Haloragis (Haloragaceae) from southeastern Polynesia. Pacific Plant Studies 34. Phyrologia 37: 441. Steudel, E.T. (1841) Nomenclator Botanicus ed. 2(2): 177. Stuttgart, Tubingen: Cotta. Stone, B.C. (1970) The flora of Guam. Micronesica 6: 446-449, t. 75, 76. Swartz, O. (1788) Nova Genera & Species seu Prodromus: 79. Upsala, Abo: Holmiae. Swartz, O. (1798) Flora Indiae Occidentalis: 912-913. Erlangen: Palm. Sweet, R. (1826) Hortus Brittanicus: 155-158. London: Ridgway. Trimen, H. (1894) A Hand-Book to the Flora of Ceylon 2: 174, 183. London: Dulau & Co. Urban, 1. (1920) Plumier's Leben und Schriften. Reperr. Spec. Nov. Regni Veg. Beihefte 5: 86. Vahl, M. (1791) Symbolae Botanicae 2: 59. Copenhagen: Vahl. Van der Merwe, M.M., van Wyk, A.E. & Botha, A.M. (2005) Molecular phylogenetic analysis of Eugenia L. (Myrtaceae), with emphasis on southern African taxa. P/. Syst. Evol. 251: 21-34. Van Ooststroom, $.]. (1937) Hermann's Collection of Ceylon plants in the Rijksherbarium (National Herbarium), at Leyden. B/umea, Suppl. 1: 198-209. Verdcourt, B. (1999) The genus Eugenia L. (Myrtaceae) in East Africa. Kew Bull. 54: 47-48. Verdcourt, B. (2001) Myrtaceae. In: Flora of Tropical East Africa: 59-60. Rotterdam, Brookfield: A. A. Balkema. Verdcourt, B., Eilu, G. & Katende, A. (2002) Proposal to conserve the name Fugenia bukobensis Engl. (Myrtaceae) with a conserved type. Zaxon 51: 389. 134 Gard. Bull. Singapore 65(1) 2013 Wilson, P.G. (2009) Conspectus of the genus Eugenia (Myrtaceae) in the Philippines. Gard. Bull., Singapore 60: 399-410. Wilson, P.G. (2011) Myrtaceae. In: K. Kubitzki 7he Families and Genera of Vascular Plants 10. Flowering plants- Eudicots- Sapindales, Cucurbitales, Myrtaceae: 227-228, 245, 252-253. Heidelberg: Springer- Verlag. Wilson, P.G., O'Brien, M.M., Heslewood, M.M. & Quinn, C.J. (2005) Relationships within Myrtaceae sensu lato based on a matk phylogeny. P/. Sysr. Evol. 251: 3-19. Instructions for contributing authors (continued) Title and authorship. The title should concisely describe the contents. If a scientific name is used, its authority 1s normally excluded, but the family name would be provided. Authors” names, affiliations and postal/ e-mail addresses are stated below the utle. If more than one author, indicate “corresponding author”. Avoid footnotes. A short running title (up to six words) should also be provided. Abstract. The abstract is at most 100-300 words. It should concisely indicate the article”s contents without summarising it; mentioning novelties and name changes. Keywords: Suggest at most eight keywords, in alphabetical order. Scientific names and author abbreviations. Genus and species names of organisms must be italicised and followed by the authority (with family name in parentheses) when first mentioned in the text or diagnoses. Standards for author abbreviations include: Brummitt, R.K. & Powell, C.E. (1992) Aurhors of Plant Names. Kew: Royal Botanic Gardens, Kew. Kirk, P.M. & Ansell, A.E. (1992) Aurhors of Fungal Names [Index to Fungi Supplement]. Wallingford: CAB International. Herbarium abbreviations (http://sciweb.nybg.org/science?/Index Herbariorum.asp) follow Holmegren, P.K., Holmegren, N.H. & Barnett, L.C. (eds) (1990) Index Herbariorum. Part 1: The Herbaria of the World [Regnum Veg. vol. 120]. New York: New York Botanical Garden. Journal and book title abbreviations. For journals: Bridson, G.D.R., Townsend, S.T., Polen, E.A. & Smith, E.R. (eds) (2004) BPH-2: periodicals with botanical content: comprising a second edition of Botanico-Periodicum-Hunlianum. Pittsburg: Hunt Institute for Botanical Documentation. For books: Stafleu, F.A. & Cowan, R. S. (eds) (1976-88) Taxonomic Literature. 2nd edition. 7 vols [Regnum Veg. vols 94, 98, 105, 110, 112, 115, 116]. Stafleu, F.A. & Mennega, E.A. (eds) (1992—) Taxonomic Literature. Supplements [Regnum Veg. vols 12553130; 1832)); (A useful source of verify ing names of publications is . If in doubt, list full titles. Other abbreviations and units of measurement. |t using standard abbreviations and acronyms, give the full term on first mention. Dates are cited as: 1 Jan 2000. SI (metric) units of measurement are used and spelled out except when preceded by a numeral; they are abbreviated in standard form: g, ml, km, etc. Tables. Tables are numbered in arabic numerals in the order they are first mentioned in the text and carry an indicative legend at the head. Tables are given at the end of the manuscript. Iilustrations. All drawings, maps, graphs and photographic images (individually or collected in a plate) are to be numbered in arabic numerals in the order they are first mentioned in the text, as Fig. 1, Fig. 2, etc. (plate components would be referred to in the text as Fig. IA, IB, Fig. IA-D, etc.). If relevant, scale bars should be used to indicate magnification. When grouping photographs, the maximum page area 19.5 x 13 cm must be heeded. High resolution digital images may be submitted as separare files (line drawings in black and white at 600 dpi, photographs at 300 dpi) sent electronically or in a CD. Do not embed images into the main text file. References in the text. Citation in the text should take the form: King & Gamble (1886) or (King & Gamble 1886), or King et al. (1886) if more than three authors to a work. Use 2000a, 2000b, etc. if several papers by the same author(s) in one year are cited. References listed at the end. There, works mentioned in the text are listed alphabetically as follows: Dallwitz, M.J., Paine, T.A. & Zurcher, E.J. (1999) User *s Guide to the DELTA Editor. http:// biodiversity.uno.edu/delta/ (accessed on 2 Aug. 2010). Persson, C. (2000) Phylogeny of Gardenieae (Rubiaceae) based on chloroplast DNA sequences from the rps 16 intron and irnL(UAA)-F(GAA) intergenic spacer. Nordic J Bor. 20: 257-269. Ridley. H.N. (1930) The Dispersal of Plants Throughout the World. Ashtord, U.K.: L. Reeve. Smith, A.C. & Darwin, S.P. (1988) Rubiaceae. In: Smith, A.C. (ed) Flora Viliensis Nova, A New Flora of Fiji 4: 143-193. References to web-based resources should include either a doi (digital object identifier) specification or full URL mentioning also the date it was accessed. Use of DNA sequences from GenBank should be acknowledged and the studies for which the sequences were generated should be cited. Style of nomenclatural summaries. The tollowing style is required: Gardenia anisophylla Jack ex Roxb., FI. Ind. ed. Carey & Wall. 2: 561 (1824). Medinilla alternifolia Blume, Mus. Bot. 1: 19 (1849). If authors include full bibliographic data for these works in the list of references at the end of the paper, they should also be mentioned in the text briefly, e.g., “Nomenelatural references researched include Blume (1849) and Roxburgh (1824).” Homotypie synonyms should be provided in a block, stating the type at the end. Front cover picture: Aspidistra jiewhoei Tillich & Skorni€k. (Photo by J. Leong-Skornickovâ) NATIONAL PARKS G, € Botan Singapore Botanic Gardens, 1 Cluny Road, Singapore 259569 Tel: 64719921 Telefax: 64674832